ID: 1148385601

View in Genome Browser
Species Human (GRCh38)
Location 17:47232467-47232489
Sequence CTGTGGTTATGTTGGCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148385599_1148385601 -8 Left 1148385599 17:47232452-47232474 CCTAAAAGGTAGAATCTGTGGTT No data
Right 1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG No data
1148385596_1148385601 -1 Left 1148385596 17:47232445-47232467 CCCAAATCCTAAAAGGTAGAATC No data
Right 1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG No data
1148385597_1148385601 -2 Left 1148385597 17:47232446-47232468 CCAAATCCTAAAAGGTAGAATCT No data
Right 1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148385601 Original CRISPR CTGTGGTTATGTTGGCAAAG AGG Intergenic
No off target data available for this crispr