ID: 1148385724

View in Genome Browser
Species Human (GRCh38)
Location 17:47233297-47233319
Sequence AGGAAAAGAGGTGGCCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148385724_1148385727 -7 Left 1148385724 17:47233297-47233319 CCACTGAGGCCACCTCTTTTCCT No data
Right 1148385727 17:47233313-47233335 TTTTCCTCTCTTCCTTTGTCAGG No data
1148385724_1148385729 2 Left 1148385724 17:47233297-47233319 CCACTGAGGCCACCTCTTTTCCT No data
Right 1148385729 17:47233322-47233344 CTTCCTTTGTCAGGTTCTGATGG No data
1148385724_1148385732 13 Left 1148385724 17:47233297-47233319 CCACTGAGGCCACCTCTTTTCCT No data
Right 1148385732 17:47233333-47233355 AGGTTCTGATGGCCTCCACTGGG No data
1148385724_1148385731 12 Left 1148385724 17:47233297-47233319 CCACTGAGGCCACCTCTTTTCCT No data
Right 1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG No data
1148385724_1148385735 30 Left 1148385724 17:47233297-47233319 CCACTGAGGCCACCTCTTTTCCT No data
Right 1148385735 17:47233350-47233372 ACTGGGTGTCCTCCCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148385724 Original CRISPR AGGAAAAGAGGTGGCCTCAG TGG (reversed) Intergenic
No off target data available for this crispr