ID: 1148385728

View in Genome Browser
Species Human (GRCh38)
Location 17:47233317-47233339
Sequence AGAACCTGACAAAGGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148385728_1148385732 -7 Left 1148385728 17:47233317-47233339 CCTCTCTTCCTTTGTCAGGTTCT No data
Right 1148385732 17:47233333-47233355 AGGTTCTGATGGCCTCCACTGGG No data
1148385728_1148385731 -8 Left 1148385728 17:47233317-47233339 CCTCTCTTCCTTTGTCAGGTTCT No data
Right 1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG No data
1148385728_1148385735 10 Left 1148385728 17:47233317-47233339 CCTCTCTTCCTTTGTCAGGTTCT No data
Right 1148385735 17:47233350-47233372 ACTGGGTGTCCTCCCTCAGATGG No data
1148385728_1148385736 15 Left 1148385728 17:47233317-47233339 CCTCTCTTCCTTTGTCAGGTTCT No data
Right 1148385736 17:47233355-47233377 GTGTCCTCCCTCAGATGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148385728 Original CRISPR AGAACCTGACAAAGGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr