ID: 1148385731

View in Genome Browser
Species Human (GRCh38)
Location 17:47233332-47233354
Sequence CAGGTTCTGATGGCCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148385726_1148385731 0 Left 1148385726 17:47233309-47233331 CCTCTTTTCCTCTCTTCCTTTGT No data
Right 1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG No data
1148385725_1148385731 3 Left 1148385725 17:47233306-47233328 CCACCTCTTTTCCTCTCTTCCTT No data
Right 1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG No data
1148385724_1148385731 12 Left 1148385724 17:47233297-47233319 CCACTGAGGCCACCTCTTTTCCT No data
Right 1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG No data
1148385728_1148385731 -8 Left 1148385728 17:47233317-47233339 CCTCTCTTCCTTTGTCAGGTTCT No data
Right 1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148385731 Original CRISPR CAGGTTCTGATGGCCTCCAC TGG Intergenic
No off target data available for this crispr