ID: 1148389234

View in Genome Browser
Species Human (GRCh38)
Location 17:47258295-47258317
Sequence CAGGGAAATGACTCTGTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148389225_1148389234 18 Left 1148389225 17:47258254-47258276 CCTGATGGAGCTCAGGCCACTAG 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1148389234 17:47258295-47258317 CAGGGAAATGACTCTGTTTAGGG 0: 1
1: 0
2: 1
3: 20
4: 159
1148389223_1148389234 29 Left 1148389223 17:47258243-47258265 CCTTCATTGTGCCTGATGGAGCT 0: 1
1: 0
2: 0
3: 17
4: 124
Right 1148389234 17:47258295-47258317 CAGGGAAATGACTCTGTTTAGGG 0: 1
1: 0
2: 1
3: 20
4: 159
1148389229_1148389234 2 Left 1148389229 17:47258270-47258292 CCACTAGTGGAAATGAAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1148389234 17:47258295-47258317 CAGGGAAATGACTCTGTTTAGGG 0: 1
1: 0
2: 1
3: 20
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148389234 Original CRISPR CAGGGAAATGACTCTGTTTA GGG Intronic
901589631 1:10329714-10329736 CAGAGCAAAGACTCTGTCTAGGG + Intronic
907744544 1:57199623-57199645 CAGGGAAATGAAGATGTTTGGGG + Intronic
908848744 1:68351890-68351912 GAGTGAAATGACTCTGTCCAGGG - Intergenic
909375599 1:74938057-74938079 CAGCCAAATCACTCTGTTAATGG - Intergenic
909862231 1:80622164-80622186 TTGGGAAATGCCTTTGTTTAGGG - Intergenic
912448535 1:109755855-109755877 CAGGGAAATGAGTCTTTTCTTGG - Intronic
912913668 1:113789468-113789490 CAGGGAAATACTTATGTTTATGG - Intronic
915148149 1:153807720-153807742 CAGGGAAAGGACTCAGCTCAGGG + Exonic
917312774 1:173694057-173694079 CAGGGAAATAGCACTGTCTAAGG + Intergenic
918039695 1:180906508-180906530 CAGGGAAATGACTGGGATTAGGG - Intergenic
920544387 1:206803293-206803315 CAGGTCAATGCCTCTGATTAGGG - Intronic
920876433 1:209840514-209840536 CAGAGAAATGACTCTTGCTAAGG - Intronic
922989356 1:229893329-229893351 CAGGGAGAACACCCTGTTTAGGG - Intergenic
924447129 1:244143872-244143894 CACAGAAATGACTCTTTTGAAGG + Intergenic
1062813527 10:482905-482927 CAGGGAGAAGACGCTGCTTAGGG - Intronic
1064421718 10:15196460-15196482 CTGGGAAATGGCTCTGTTCTAGG + Intergenic
1065646209 10:27836364-27836386 CAGGGAAATGAGTGTGTGTTTGG - Intronic
1067511573 10:46899106-46899128 CAGTGGAAGGACTCTGTTAAGGG + Intergenic
1067650674 10:48152733-48152755 CAGTGGAAGGACTCTGTTAAGGG - Intergenic
1068513321 10:57993942-57993964 TAGGGACATCACTCAGTTTAGGG + Intergenic
1077917173 11:6618932-6618954 CAGGGACATGGCTTTGGTTAGGG + Intronic
1078519892 11:12054223-12054245 GAGGGAAATCACTATGTTGAAGG - Intergenic
1078869714 11:15332132-15332154 CAGGGTTATGCCTCTTTTTAAGG + Intergenic
1078900383 11:15636774-15636796 CAGTGAGGTGACTCTGTTTCTGG + Intergenic
1079363752 11:19791590-19791612 CATGGAACTAACTCTTTTTAGGG - Intronic
1084358677 11:68655770-68655792 CATGGGAATGTCTCTGTCTAGGG - Intergenic
1086371445 11:86159363-86159385 CAGGTAAATAATTATGTTTATGG - Intergenic
1086407217 11:86508717-86508739 GATGGAAATGACTCTGGTTTAGG + Intronic
1087180894 11:95141516-95141538 CAGGTACATGACTATGTTTTTGG - Intergenic
1090427364 11:126617646-126617668 TAGGGATTTGACTCTGTTTTAGG + Intronic
1091360847 11:134977564-134977586 CATGGAAATGCCTCTGTCGAAGG - Intergenic
1092073812 12:5656420-5656442 CAAGGGAATGCCTCTGTTTCAGG - Intronic
1093239232 12:16648966-16648988 AAGGGCAATGACTGTTTTTATGG + Intergenic
1097008548 12:55936275-55936297 CAGGGAAAGGAAGATGTTTAGGG + Intronic
1097726377 12:63079870-63079892 CAGGCAAGTGACTCTGTTTAGGG + Intergenic
1097729808 12:63115866-63115888 CAGGCACATGACTTTGTTTCTGG - Intergenic
1098271293 12:68772818-68772840 CAGGAAACTGACTCTTTTTGGGG - Exonic
1099988142 12:89693138-89693160 CAAGGAAATGACTGTGCCTAGGG + Intronic
1101342490 12:103855380-103855402 GAGGGAAAGTAGTCTGTTTATGG - Intergenic
1101911136 12:108860823-108860845 CCTGGAAATGACACTGCTTAAGG - Intronic
1102349827 12:112184238-112184260 CAGGGAAGTGACTGTGTACATGG + Exonic
1104204854 12:126628904-126628926 CAGGGTAATGTCTCTATTTAAGG + Intergenic
1106211377 13:27650530-27650552 CATAGAAATGTCTTTGTTTAGGG - Intronic
1106585219 13:31051410-31051432 CAGGTAAATGACACTGTTCCTGG + Intergenic
1107742425 13:43465504-43465526 CAGAGAAATGACTGAGTTTGTGG - Intronic
1108694695 13:52892698-52892720 TATATAAATGACTCTGTTTAGGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1115752507 14:36506102-36506124 CTGGGAAACGACTCGGGTTAGGG + Intronic
1116285462 14:42965967-42965989 CAGGGAAATAACTTAGTCTAAGG - Intergenic
1117261281 14:54036225-54036247 CAGGGCAATCACTATGTTGATGG - Intergenic
1119761440 14:77154847-77154869 CAGGGAAATGAGTATTTTAAAGG - Intronic
1122577867 14:102752975-102752997 CAGGGGAATGACTTTGTCTGAGG + Intergenic
1202943260 14_KI270726v1_random:3152-3174 CAGAGAAATGACTCTGTCCTTGG - Intergenic
1127600620 15:60532942-60532964 CAAAGAAATTACTCTGTGTAAGG - Intronic
1128426018 15:67542976-67542998 CAGGGCAAGGACTCGGTTTGGGG - Exonic
1128539428 15:68515970-68515992 GAGGAAAATGTGTCTGTTTAGGG + Intergenic
1129684151 15:77675765-77675787 CAGAAAAATGATTCTGCTTAGGG + Intronic
1131155507 15:90072936-90072958 CTGGGAAATGTCTCTTTTTGAGG - Intronic
1136546823 16:30959146-30959168 GAGGGAAAAGTCTCTGTTTTTGG - Exonic
1137682462 16:50362049-50362071 GAGAGAAATGGCTCTTTTTATGG - Intronic
1138178376 16:54925224-54925246 AATGGAAATGATTCTGTTTAAGG + Intergenic
1139311531 16:66032078-66032100 CGGGGTAATGGGTCTGTTTAAGG - Intergenic
1140521987 16:75589599-75589621 CAGGGAAATGTCTCTGTGGGAGG - Intergenic
1140580161 16:76222149-76222171 CAGGGAAGTTACTCTTTTTCTGG - Intergenic
1140953246 16:79839160-79839182 CAGGGAAATGTGTCTGTGAAGGG - Intergenic
1141577959 16:84976822-84976844 CAGGGAACTGACTGCCTTTAGGG - Intronic
1141848589 16:86628472-86628494 CAGGGCAATGCCTGTTTTTATGG + Intergenic
1144127673 17:12218041-12218063 GTGGGAAATGGCTCTGTTTGAGG + Intergenic
1148389234 17:47258295-47258317 CAGGGAAATGACTCTGTTTAGGG + Intronic
1150294869 17:64002246-64002268 CAGCGAACTGACTCTGCTCAGGG - Exonic
1150601801 17:66657485-66657507 CAGGGACATGGCTCTTTTTCTGG + Intronic
1152657459 17:81526692-81526714 CAGGGAACTGTCTCTGGTTTAGG - Intergenic
1156714767 18:39994663-39994685 TAGGGAAATTACTCTGGCTATGG - Intergenic
1156878796 18:42050141-42050163 CTGGAAAATGCCTCTTTTTATGG + Intronic
1158027265 18:52915203-52915225 TAGGGAAATGGCCCTGTTAAAGG + Intronic
1159602050 18:70437366-70437388 CAGGGCAATTACTATGTTTCAGG - Intergenic
1160448330 18:78944309-78944331 CAGGGAAATGACTCTTCTTTTGG - Intergenic
1165983347 19:39745640-39745662 CATAGAAATGATTCTGTTAAAGG + Intergenic
1166739141 19:45103675-45103697 CAGGGAAGTGACTCTCTGCAGGG + Intronic
928505164 2:31944033-31944055 CAAGGAAATGACTGTGATGATGG - Intronic
931218487 2:60267660-60267682 CAGGGAAAGGTCTTTGTTTTAGG - Intergenic
932518583 2:72381722-72381744 CAGTTAAATGACTCTGCTTATGG + Intronic
935832323 2:107013058-107013080 GAAGGAAATGGCACTGTTTAGGG + Intergenic
939095533 2:137829464-137829486 GAAGGTAATGAGTCTGTTTATGG - Intergenic
941277612 2:163509973-163509995 CAGGCAAATGACATGGTTTATGG - Intergenic
943610432 2:190026976-190026998 TAGGTAAATTACTCTGTTTATGG - Intronic
943939004 2:193965789-193965811 CAGGGAAATGCCTTTATTAAAGG + Intergenic
945188219 2:207161144-207161166 CATGGAAATGAATCTATTAAAGG + Intronic
945883949 2:215354997-215355019 CTGGAAAACGACTCAGTTTAGGG + Intergenic
948130901 2:235599922-235599944 CAGGGAAGTGCCTGTGTTCAGGG + Intronic
1169545136 20:6642270-6642292 TAGGGAAATGGCTGTGTGTATGG + Intergenic
1172853075 20:37980767-37980789 GAGGGAAATGCCTCTAATTACGG - Intergenic
1174434578 20:50496941-50496963 AGGGAAAATGACTCTGTTTAGGG + Intergenic
1178358958 21:31932357-31932379 AAGGGCAGTGACTCAGTTTATGG + Intronic
1182906927 22:33946136-33946158 CAGGAAAATGACTCTCGCTAAGG + Intergenic
1185273456 22:49939073-49939095 CTGGGGCAGGACTCTGTTTAGGG + Intergenic
949328504 3:2894725-2894747 TAGAGAAATGAATCTGTGTAAGG + Intronic
950694634 3:14689414-14689436 CAGTGAAATGACTATATTTGGGG + Intronic
953140468 3:40224892-40224914 CAGGGACATGAGTCTGTTCATGG + Intronic
953207464 3:40844117-40844139 GAGGAAATTGTCTCTGTTTAGGG - Intergenic
955891902 3:63659189-63659211 CTGGGAGATCACTCTGTTTTAGG + Intronic
956547938 3:70426654-70426676 CATGGAAATGACTCTGATATTGG - Intergenic
957133297 3:76250593-76250615 CAGGGATATGAAACTGTTCAAGG - Intronic
958617091 3:96508639-96508661 CAGAAAAATGACACTGTTTATGG - Intergenic
958712826 3:97739001-97739023 CAGAGAACTGAGACTGTTTAGGG + Intronic
959220297 3:103510017-103510039 CAGAGAAATCACATTGTTTAAGG + Intergenic
966349886 3:179021743-179021765 CAGAGAAAAAACACTGTTTATGG + Exonic
971166073 4:24185097-24185119 CAGGCAAATGCCTGTGTTTGAGG - Intergenic
975373734 4:73618464-73618486 AAGGCAAATAACTTTGTTTAAGG + Intronic
976357541 4:84136791-84136813 CAGAGAAATGATTTTGTTTATGG - Intergenic
976758205 4:88520868-88520890 CCAGGAAATGATTCTGTTTTGGG + Intergenic
982074473 4:151724790-151724812 CAGGGAACTCAGTCTGTTTGGGG - Intronic
984103152 4:175511776-175511798 GAGGCAAATGACTCTGTAGAGGG - Intergenic
986253722 5:6083993-6084015 CAAGAAAATAAGTCTGTTTATGG - Intergenic
987139899 5:14934459-14934481 CAGGGAAATGTCTCTATTTCTGG + Intergenic
987944736 5:24590130-24590152 CAGGAAAATGCTTCTATTTATGG + Intronic
993142237 5:84049772-84049794 CTGAGAAATGCCTCTGTTTAGGG + Intronic
994445299 5:99864585-99864607 CAAGGCAAAGACTCTGTTTATGG - Intergenic
994998697 5:107099615-107099637 CAGGAAAATGATTCTCTTGAAGG + Intergenic
997223993 5:132195159-132195181 CTGGGAAATGTCTCTGTTGCTGG - Intronic
998605422 5:143628854-143628876 GTGTGAAATGACTTTGTTTATGG + Intergenic
1002122783 5:177018509-177018531 CAGGGAAATGACTTTGCTAAGGG - Intronic
1002311315 5:178315544-178315566 CAGGGAAATGACTGTGGTTTTGG + Intronic
1002557669 5:180056502-180056524 GAGGGAAATGCCTCAGTTTCTGG + Intronic
1007160909 6:39791358-39791380 TAGGGAAATGGCTTGGTTTAAGG - Intergenic
1007193464 6:40039365-40039387 GAGGGAAAGCACTCTATTTAGGG + Intergenic
1007595039 6:43046072-43046094 CAGGCAACTGACTCTGCTTGTGG - Exonic
1007640204 6:43332088-43332110 AAGGGAAATGAGTATGTTTAAGG - Intronic
1008394942 6:50995286-50995308 GCGGGAAATGACTCTGTGGAAGG - Intergenic
1008421516 6:51305900-51305922 CTGGGAAATGTAACTGTTTAGGG + Intergenic
1008654185 6:53594403-53594425 GAGACAAATGAGTCTGTTTAAGG - Intronic
1010123004 6:72401089-72401111 CAGGGAAATAACACTGCTTGTGG - Intronic
1010649898 6:78441453-78441475 CATGGAATTGATCCTGTTTATGG - Intergenic
1012210746 6:96516019-96516041 AAGGTAAATGAATCTGTTTTTGG - Intergenic
1013833578 6:114304033-114304055 CAGAGAAATGACTGTGCATATGG - Intronic
1013904874 6:115203569-115203591 CCGGAAAATGACTCTGTTTTTGG + Intergenic
1014039667 6:116811398-116811420 CAGGAAAATGACACTTTTAAAGG + Intronic
1014587443 6:123217088-123217110 CAGATTAATGACTCTCTTTATGG - Intronic
1016337666 6:143025202-143025224 CATAGAAATCACTCAGTTTATGG - Intergenic
1017361033 6:153571823-153571845 TAGAGAAATGGCTCTGTTTGGGG - Intergenic
1018408797 6:163519154-163519176 CAGTGAAATGAATCTGATTGGGG - Intronic
1023288352 7:38643018-38643040 CAGGGAAATGTATATATTTAAGG + Intergenic
1023498820 7:40826926-40826948 CAAGAAAATAAATCTGTTTAAGG + Intronic
1024730614 7:52249960-52249982 CAGGGTGATGTTTCTGTTTAGGG - Intergenic
1026213195 7:68324882-68324904 CAGGGATATTAATCTGTATATGG - Intergenic
1027486031 7:78762654-78762676 CAAGAAAATGACTCCGTTTTGGG + Intronic
1027595421 7:80167970-80167992 CATGGAAAGTACTCTGTTGATGG + Intronic
1028577574 7:92369499-92369521 CTGGGAAGTGGCTCTGTGTATGG - Intronic
1028642582 7:93059720-93059742 CAGGGAAATGACTACCATTAAGG - Intergenic
1033730021 7:144169214-144169236 TAAGGAAATGATTCTGCTTATGG - Intergenic
1034699356 7:153083136-153083158 CAGGGGAATGCCTCTGTCCAGGG + Intergenic
1034761297 7:153674445-153674467 CAGGGAAGTGACCGTGTTTTCGG - Intergenic
1035312270 7:157977028-157977050 CATGGAAACTACTGTGTTTATGG - Intronic
1036000285 8:4594871-4594893 AAGAGAAATGACTCTGTAAAAGG + Intronic
1036758780 8:11492223-11492245 CAAGGAAATGACTTTGCTCATGG - Intergenic
1041153887 8:54963830-54963852 CTGAGATATGACTCTGTATATGG + Intergenic
1041863081 8:62536129-62536151 CAAAGAAATGACTCTATTTTTGG + Intronic
1045656982 8:104397459-104397481 CTGGGACATGACTGTGTTTTGGG + Intronic
1046225033 8:111267382-111267404 CAGGGCAATGACTCAAATTATGG - Intergenic
1046673657 8:117085031-117085053 CAAGGAATTGATTCTGTTTCTGG + Intronic
1046695722 8:117337244-117337266 AAGTTAAATGACTTTGTTTATGG - Intergenic
1049003649 8:139841513-139841535 CACGGAAATGACTGTGCTCATGG + Intronic
1049210801 8:141385653-141385675 CAGGAAAATGACACTGTTTCTGG - Intergenic
1049823061 8:144647874-144647896 CAGGGCAATGAGTCTGGATATGG - Intergenic
1052415719 9:28174597-28174619 TAGGGAGATGACTCTGATTGAGG + Intronic
1055341760 9:75292147-75292169 CAGGGAAATTCCACTGTATAAGG + Intergenic
1056167750 9:83955380-83955402 CAGAGATGTGACTCTGTTTGAGG - Exonic
1056224508 9:84482175-84482197 AAGGGAATTGTCTCTGTTTAAGG - Intergenic
1056432927 9:86546682-86546704 CTGAGAAATGAGTCTGATTATGG - Intergenic
1186543688 X:10426599-10426621 CAAGGAAGTGACTCTGATGAGGG - Intergenic
1191136369 X:57069399-57069421 TATGGAATTGACTGTGTTTATGG - Intergenic
1191784937 X:64907250-64907272 CAGGGAAATGACACTGACTCAGG - Intergenic
1194797578 X:98231404-98231426 CAGAGAAATGAGTCTGTGAATGG + Intergenic
1196850635 X:119934807-119934829 TAGGAAAATGCCTCTTTTTACGG + Intronic
1196939193 X:120759246-120759268 CAGGGCAATCACTCTGTGAATGG - Intergenic
1197322911 X:125054885-125054907 AAGTGAAATTACTGTGTTTAAGG + Intergenic
1197626426 X:128807437-128807459 AAGGGAAATGACTTGGTGTAAGG + Intergenic
1198662249 X:138982219-138982241 CAGGGATATGATTTTGTTAAGGG + Intronic
1198703443 X:139421452-139421474 GAGGGAACCAACTCTGTTTAAGG - Intergenic
1198945089 X:142002765-142002787 TAAAGAAATGACTCTGTTTAAGG - Intergenic
1201371586 Y:13270148-13270170 CAAGGAAATGACTGTGTTCTTGG + Intronic