ID: 1148394458

View in Genome Browser
Species Human (GRCh38)
Location 17:47296930-47296952
Sequence CTATTTAAGCGAAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148394458 Original CRISPR CTATTTAAGCGAAGGGTGGA TGG (reversed) Intronic
901366247 1:8751460-8751482 GAATTTAAGAGAAGGGTGGAAGG + Intronic
906283738 1:44571926-44571948 CTATTTAAGGGTAGGATGAACGG - Intronic
906384015 1:45351801-45351823 CTATTTCAGGGAAGGGCGAAGGG - Intronic
907802832 1:57788993-57789015 TTGTTTAAGCGAAGGGTGGGGGG - Intronic
916421774 1:164644463-164644485 TTTTGTAAGCGAAGGGTGGCAGG - Intronic
916506903 1:165436324-165436346 CTATTTTACCAAAGGGTGGGAGG - Intronic
919592425 1:199521306-199521328 CTATTTGAGGGAAGTGTTGAAGG - Intergenic
921655932 1:217737451-217737473 ATCTTTAAGGGAAGGGAGGAGGG + Intronic
1063851601 10:10198549-10198571 ACATTTGAGGGAAGGGTGGAAGG - Intergenic
1073188509 10:101632448-101632470 CTATTTTAACGAAGGGTACAAGG + Intronic
1074425375 10:113346706-113346728 CTCTCCAAGGGAAGGGTGGAAGG - Intergenic
1078477683 11:11645713-11645735 CTCTTTAAGCAAATGGGGGATGG - Intergenic
1079235530 11:18686555-18686577 CTGTTTAAGCAAATTGTGGAAGG + Intergenic
1087837047 11:102885847-102885869 TTATTTAAGTGACAGGTGGATGG + Intergenic
1088022111 11:105132245-105132267 CTATTTCAGCTTGGGGTGGAAGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091491570 12:937118-937140 CCATCTAAAGGAAGGGTGGACGG - Intronic
1092368359 12:7895896-7895918 CTATTGAGGTGAAGGGTGAAGGG - Intergenic
1092834616 12:12475983-12476005 CGATTTAAGCTAAGGTTGGGAGG - Exonic
1097199336 12:57264967-57264989 CTATTTGAGGGTAGGGTGAAAGG + Intronic
1099413193 12:82357820-82357842 AAATTAAAGCGAAGGCTGGAGGG + Intronic
1116579894 14:46626821-46626843 CTACTTGAGCGGAGGGTGGATGG + Intergenic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1122281700 14:100627043-100627065 CTCTCTAAGCTAAGTGTGGAAGG - Intergenic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1140278715 16:73534312-73534334 ATATTTAAGCAAAGAGTTGAAGG - Intergenic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1143123742 17:4627252-4627274 CTATTTGAGCAAAGGGTGATAGG - Intergenic
1144325826 17:14178714-14178736 CCATTTAAGTGAAGAGTGGTTGG - Intronic
1148394458 17:47296930-47296952 CTATTTAAGCGAAGGGTGGATGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153549875 18:6251165-6251187 CTATTTTAGCGAAGCCTGCAAGG - Intronic
1154043302 18:10880003-10880025 CTATTTCAGCGCAGGGGAGAGGG + Intronic
929483744 2:42337148-42337170 GAATTTAAGCAATGGGTGGATGG - Intronic
932533754 2:72568621-72568643 CTATTTAAGTGAAGCGTATATGG + Intronic
933381728 2:81556743-81556765 TTATTTTTACGAAGGGTGGAAGG - Intergenic
937004108 2:118495885-118495907 CAATTTAGGCAAAGGGTGAAGGG - Intergenic
937501989 2:122489239-122489261 CTATTTAAGCTTAGTGTTGAAGG + Intergenic
940519766 2:154729865-154729887 CTATTTAAGCCATGGTTGGTTGG - Intronic
941233721 2:162943295-162943317 GTATTTAACCTGAGGGTGGAGGG - Intergenic
946736383 2:222758390-222758412 CTATATAAGAGATGGATGGATGG + Intergenic
946767839 2:223056546-223056568 TTTTTTAAGCCATGGGTGGAAGG + Intronic
1177914200 21:27067983-27068005 CTATTTGAGGGGAGGGTGGGGGG + Intergenic
1179369335 21:40790126-40790148 CTATTTAACCAAAAGGTGTATGG - Intronic
1182149921 22:28020705-28020727 CTCTTTAAGCTGAGTGTGGATGG - Intronic
949428200 3:3942017-3942039 CTATTTGAGGCAGGGGTGGAGGG - Intronic
959677771 3:109055767-109055789 CTCTTTTACCGAAGGGTGGCAGG + Intronic
965398523 3:168189569-168189591 CTATTTGAGGGAAGGGGAGAGGG + Intergenic
966618078 3:181933766-181933788 CTTTTTAGGCCAAGGGTGGGTGG + Intergenic
967499960 3:190186150-190186172 TTATTTAGGCGATGGGTGCAAGG + Intergenic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971641560 4:29139800-29139822 TAATTTAAGTGAAGGTTGGAGGG - Intergenic
975330251 4:73104738-73104760 CTATTTAAGCGGGAGGTGGGGGG + Intronic
977294197 4:95193038-95193060 CTCTTGAAGGGAAGGCTGGAAGG + Intronic
981260329 4:142711200-142711222 CTATTTGAGCAAAGACTGGAAGG - Intronic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
985851133 5:2389751-2389773 ACATTTGAGTGAAGGGTGGAAGG - Intergenic
986759780 5:10869371-10869393 CTATTTTAGGGAAAGGTGGATGG + Intergenic
991335121 5:65538551-65538573 ATATTTAAACGAAGTGTTGAAGG - Intronic
991556291 5:67898274-67898296 CTAATTAAGCAAGGGGTGGGAGG - Intergenic
998715069 5:144873960-144873982 CTATTTAAGCCAATGCTTGAGGG + Intergenic
1004553782 6:16675453-16675475 AAATTAAAACGAAGGGTGGAGGG + Intronic
1017293590 6:152769294-152769316 TTATTCAAGCTAATGGTGGACGG - Intergenic
1018312116 6:162521320-162521342 CTAGTAAAGCAAAGGATGGATGG + Intronic
1023347911 7:39290314-39290336 CTACTCAAGCGAAAGGTGCAAGG - Intronic
1024560457 7:50640486-50640508 CTTCTAAAGAGAAGGGTGGAGGG - Intronic
1024942581 7:54777769-54777791 GTATTTAAGAGAAGGGAGCAGGG + Intergenic
1027357663 7:77374774-77374796 CTATTTAATCGCAGGGAGAAGGG + Intronic
1031551053 7:123112033-123112055 CTATCCAAGTTAAGGGTGGATGG - Intergenic
1034868311 7:154659370-154659392 CTAATTAAGTGAAGGGTTAAGGG + Intronic
1035351722 7:158252084-158252106 CTGCTTAGGCGAAGGATGGATGG - Intronic
1047242778 8:123108091-123108113 CAATGTAAGAGAAGGGTGAAGGG - Intronic
1048755389 8:137732676-137732698 ATATATAAGCAAAGGGTTGAGGG + Intergenic
1053536849 9:38934918-38934940 GTACTTGAGTGAAGGGTGGAAGG - Intergenic
1054629287 9:67429012-67429034 GTACTTGAGTGAAGGGTGGAAGG + Intergenic
1060493646 9:124102455-124102477 TTATTGAAGGGAAGGGTGGATGG - Intergenic
1062489059 9:136795723-136795745 CCCTCTAAGGGAAGGGTGGAGGG + Intronic
1195135535 X:101903942-101903964 ATATTTAATACAAGGGTGGATGG + Intronic
1198152185 X:133922204-133922226 CTTTTTAAGAGAAGGCTAGAGGG + Intronic
1199804516 X:151284592-151284614 ATATTTCAGGGAAGGGGGGAAGG - Intergenic
1200090640 X:153634303-153634325 CTCCTTCAGTGAAGGGTGGAGGG + Intergenic