ID: 1148395001

View in Genome Browser
Species Human (GRCh38)
Location 17:47300781-47300803
Sequence TGGGAAGCAGAAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 943
Summary {0: 1, 1: 0, 2: 4, 3: 108, 4: 830}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148395001_1148395008 14 Left 1148395001 17:47300781-47300803 CCATCCACCACTTCTGCTTCCCA 0: 1
1: 0
2: 4
3: 108
4: 830
Right 1148395008 17:47300818-47300840 AGCAAGAGCCTGCAAAGCAAAGG 0: 1
1: 0
2: 4
3: 20
4: 284
1148395001_1148395009 15 Left 1148395001 17:47300781-47300803 CCATCCACCACTTCTGCTTCCCA 0: 1
1: 0
2: 4
3: 108
4: 830
Right 1148395009 17:47300819-47300841 GCAAGAGCCTGCAAAGCAAAGGG 0: 1
1: 0
2: 3
3: 21
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148395001 Original CRISPR TGGGAAGCAGAAGTGGTGGA TGG (reversed) Intronic
900074022 1:797562-797584 TGGGAAGCAGCAGAGCAGGAAGG - Intergenic
900289005 1:1915939-1915961 TGGGCAGCAGCAGTGGTGGCAGG + Intronic
900838262 1:5023742-5023764 TGGGAGGCTGAGGCGGTGGATGG + Intergenic
901543321 1:9936053-9936075 TGGGAAGCAGAAGTTGCAGTGGG + Intronic
901700492 1:11042651-11042673 TTGGAAGAATGAGTGGTGGAAGG + Intronic
902328544 1:15718653-15718675 TGGGAAGCAGAGGAGGGGGCAGG + Intronic
902339647 1:15774688-15774710 CGTGAAGCAGGAGGGGTGGAAGG - Exonic
902534343 1:17110654-17110676 CAGGGAGCTGAAGTGGTGGAAGG - Intronic
902541837 1:17161354-17161376 TGGAATGCAGATGTGATGGAGGG - Intergenic
902584420 1:17429632-17429654 TGGGCAGCAGAAGTGATGTGAGG - Intronic
902816530 1:18919477-18919499 AGGGAAGCAGAAGTGGGGAGGGG + Intronic
903551591 1:24160965-24160987 TGGGAGGCCGAGGTGGTGGGAGG - Intronic
904743931 1:32699492-32699514 TGGGATGCAGAAGAGGGGGATGG - Intronic
904913327 1:33951582-33951604 AGGGAACCTGAAGTGGAGGACGG - Intronic
905629771 1:39512061-39512083 TGGGAAGCAGAGGGAGAGGAGGG - Intronic
905667988 1:39774129-39774151 TGGGAAGCAGAGGGAGAGGAGGG + Intronic
906244952 1:44266982-44267004 AGGGAAGCTGAAGGGATGGAAGG + Intronic
906271443 1:44482336-44482358 AGGGGAGCAGGAGGGGTGGAGGG + Intronic
906326592 1:44850034-44850056 TTGGGAGCAGGGGTGGTGGAGGG + Intergenic
906532500 1:46531795-46531817 AGGGCAGCAGTAGTGGTTGAGGG - Intergenic
907336098 1:53700552-53700574 TGGGTCCCAGAAGGGGTGGAGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908013880 1:59811979-59812001 TGGGAGGCTGAGGTGGTGGGAGG - Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908813568 1:68009020-68009042 TGGGAAGCACAAGGGGTCAAGGG - Intergenic
909261300 1:73492094-73492116 TGGGAAGCACAAGTGGTCAGGGG - Intergenic
909793187 1:79701062-79701084 GGGGAAGGAGAAGGGGTTGAGGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
911399540 1:97358009-97358031 TGGGAAGCACAAGTGGTTGGGGG + Intronic
911470963 1:98317630-98317652 TGGGAAAAAGAGGGGGTGGAGGG - Intergenic
911594750 1:99787434-99787456 TGGGAGGCTGAGGTGGTGGGAGG - Intergenic
911796022 1:102077073-102077095 CAGGAAGCAGAAGTGAGGGATGG - Intergenic
912391778 1:109307838-109307860 GGAGAGGCAGCAGTGGTGGAGGG + Intergenic
913408049 1:118517721-118517743 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
913648879 1:120890379-120890401 TTGCAAGCAAATGTGGTGGAGGG - Intergenic
914077812 1:144373004-144373026 TTGCAAGCAAATGTGGTGGAGGG + Exonic
914101367 1:144593501-144593523 TTGCAAGCAAATGTGGTGGAGGG - Exonic
914172721 1:145241544-145241566 TTGCAAGCAAATGTGGTGGAGGG + Intergenic
914297613 1:146344135-146344157 TTGCAAGCAAATGTGGTGGAGGG + Intergenic
914428748 1:147600656-147600678 TGGGATGCAGGAGTGTTGGAGGG + Intronic
914527378 1:148482672-148482694 TTGCAAGCAAATGTGGTGGAGGG + Exonic
914639016 1:149584456-149584478 TTGCAAGCAAATGTGGTGGAGGG - Exonic
914748757 1:150518224-150518246 TGGGAAGAAGAATAGTTGGAGGG - Intergenic
914790047 1:150869651-150869673 TGGGAGGCTGAGGTGGTGGGAGG - Intronic
915312009 1:155009637-155009659 TGGGGAGAATGAGTGGTGGAGGG - Intronic
915365685 1:155314292-155314314 TGGGAGGCTGAGGCGGTGGAAGG - Intronic
915385824 1:155490855-155490877 TGGGAGGCTGAAGTGGAGAATGG + Intronic
915457637 1:156051244-156051266 GGTGAAGCAGGCGTGGTGGAGGG + Exonic
915914878 1:159934826-159934848 TGGGATGCACAAGGGGAGGAAGG + Intronic
916249904 1:162726848-162726870 TGTGAAGCAGCAGTGATGCACGG - Intronic
916942878 1:169694699-169694721 TGTGAAGGAGAAGTGGGGCAGGG - Intronic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917910408 1:179638717-179638739 GGGGAAAAAGAAGTGGGGGATGG + Intronic
918876179 1:190046416-190046438 AGGGAGGCAGAAATGGGGGAGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920266370 1:204726519-204726541 TGGGGTGCAGAAGAGGAGGAGGG - Intergenic
920350194 1:205332870-205332892 GGGGAAAGAGAAGTGATGGAGGG + Intergenic
920465399 1:206179896-206179918 TAGGAAGCAGAAATGATTGAAGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
921674730 1:217965220-217965242 AGGGAGGCAGAAGTGGAAGAGGG - Intergenic
921890271 1:220346668-220346690 AGAGAAGCAGAAGGGTTGGATGG + Intergenic
922269875 1:224022467-224022489 TGGGAAGCAGCAGAGCAGGAAGG - Intergenic
922301748 1:224307592-224307614 TGGGAGGCTGAGGTGGGGGATGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922906176 1:229175317-229175339 TGTGAAGGAGAAGGGGTTGAGGG - Intergenic
923336203 1:232972529-232972551 TGGGAGGCTGAGGTGGAGGATGG - Intronic
923446295 1:234074519-234074541 TGGAAAGATGAAGTGGGGGAGGG + Intronic
923491282 1:234486188-234486210 TGGGATGCAGAGGTGGAGGAGGG - Intergenic
923500714 1:234561339-234561361 TGGGCAGTAGGAGTGGTAGAGGG + Intergenic
923720581 1:236463728-236463750 TAGGAAGCAGAAATGGGGAATGG - Intronic
923921582 1:238570476-238570498 TGAGAAGCAGAAGTGGTAAGTGG - Intergenic
923928283 1:238661195-238661217 TGGGAACCTGAAGTAGTTGAAGG + Intergenic
924539547 1:244968758-244968780 TGGGAAGCTGAAATGTTGGCGGG + Intergenic
924595648 1:245442627-245442649 TGGGAAGCAGCAGAGGTGAGCGG + Intronic
1063064493 10:2594692-2594714 GGGGCAGCAGAAGTGAAGGACGG + Intergenic
1063447339 10:6127638-6127660 TGGGAAACAGAAGAGGAGGTGGG + Intergenic
1064206564 10:13329356-13329378 TATGAAGGAGAATTGGTGGAAGG - Intronic
1064639344 10:17399674-17399696 TGGGAGGCAGAGGTAGGGGAGGG + Intronic
1064680358 10:17805895-17805917 TGAGAAGCAGAATGGGTGTATGG - Intergenic
1065006401 10:21384213-21384235 TGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1065009740 10:21410558-21410580 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1065144541 10:22754899-22754921 TGGGAGGCTGAGGTGGAGGATGG + Intergenic
1065444035 10:25779286-25779308 TGGGAAGCTGAGGTGGTGGGAGG - Intergenic
1065444796 10:25787232-25787254 CAGGCAGCAGAAGTGGTGAAAGG - Intergenic
1065898905 10:30187749-30187771 TGGGAAGCCAACGGGGTGGAAGG + Intergenic
1066200547 10:33139643-33139665 AGAGAGGCAGAAGAGGTGGATGG - Intergenic
1066681900 10:37942758-37942780 TGGGAACAAGGAGTGGTGGCGGG - Intergenic
1067028321 10:42863117-42863139 TGGTAAGCAGAAGTGCTCGAGGG - Intergenic
1067231152 10:44411654-44411676 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1067837503 10:49650757-49650779 TGGGAAGCTGAAGAGCGGGAAGG + Intronic
1068242655 10:54324143-54324165 TAGGAAGCAGAAGTGAGGGAAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068887686 10:62114495-62114517 TGGGAAGAAGAAGTGGAGCAGGG + Intergenic
1069713478 10:70505913-70505935 TGGGAGGCTGAGGTGGTGGGAGG + Intronic
1069938488 10:71936738-71936760 TGGGAGGCCAAGGTGGTGGATGG - Intergenic
1070143604 10:73757397-73757419 TGGGAAGCAGAGGTGGAGGCAGG + Intronic
1070421931 10:76245800-76245822 TGGAAAGTAGCAGTGGAGGAGGG + Intronic
1070699906 10:78594135-78594157 AGTGAAGCAGAAGGAGTGGAGGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071490505 10:86133367-86133389 TGGTAAGCAGCAGTGGAGAAAGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072380031 10:94858459-94858481 TGGGAAGCACAAGAGGTTGGGGG - Intergenic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072480587 10:95807444-95807466 TGGGAAGCACAAGGGGTTGGGGG - Intronic
1072806988 10:98429937-98429959 TGGGAGGCAGAAGGGGTGGAGGG - Intronic
1072894938 10:99358755-99358777 TGGCAGGCAGAGGTGGGGGAGGG - Intronic
1072917416 10:99547173-99547195 TGGGAGGCTGAGGCGGTGGATGG + Intergenic
1073198987 10:101719500-101719522 TGGGAGGCAGAGGTGGAGGCTGG - Intergenic
1073515368 10:104071138-104071160 AGGGAAGCAGGAGAGGTGGGAGG + Intronic
1073977543 10:109118070-109118092 TGGGGAACAGAAGAGGGGGATGG - Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075055265 10:119213763-119213785 TGAGAAGCAGGGGTGGGGGAAGG - Intronic
1075087724 10:119424559-119424581 TGGGAATCAGGGGTGGTGGGTGG - Intronic
1075562736 10:123480248-123480270 TGGGAAGAAGAAGGGGTGGCTGG + Intergenic
1075585696 10:123656562-123656584 TCCGAAGCAAAAGTGGTGCATGG + Intergenic
1075805384 10:125184918-125184940 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076979009 11:195512-195534 TGGGCAGCTGAAATGCTGGAAGG - Intronic
1077139760 11:1019067-1019089 TGGGGAGCAGAGGTGCAGGAGGG - Intronic
1077308074 11:1876703-1876725 TGGGAGGTAGAAGTGGGGGTGGG + Intronic
1077628565 11:3795198-3795220 TGGGAGGCCGAGGTGGGGGATGG + Intronic
1077847694 11:6043278-6043300 TGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1078222251 11:9361717-9361739 GGGGAAGGAGAAATGGTGGTGGG - Intergenic
1078244872 11:9564912-9564934 AGGGATGAAGAAGTGGTAGAGGG - Intergenic
1078482600 11:11691726-11691748 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1079248632 11:18771560-18771582 TGGGATGCAGAGGTGGTTGAGGG - Intronic
1079390926 11:20021685-20021707 TGGGAAGCAGAGGTGGGGGTGGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080438857 11:32271875-32271897 TGGGAAGGAGAACGGGTGGCTGG - Intergenic
1080848152 11:36044515-36044537 TGGGAAGGGGAAGCGGAGGATGG - Intronic
1081514319 11:43810568-43810590 TGGAAAGAAAAGGTGGTGGAGGG - Intronic
1081691959 11:45084703-45084725 TGGGAGGCTGAGGTGGAGGAAGG - Intergenic
1081779368 11:45699380-45699402 TTGGAAGCAGAACTGGGGGCAGG - Intergenic
1083340825 11:61957363-61957385 TGGGGGGCAGAAGAGGGGGATGG - Intronic
1083792383 11:64994375-64994397 TGGGATGGAGAAGAGGTGGCTGG + Intronic
1084495465 11:69500805-69500827 TGGGAAGCAAGAGGGGTGCATGG - Intergenic
1084577062 11:69995864-69995886 TGGGAGGCAGAGGTGGAGGCGGG + Intergenic
1084612140 11:70210041-70210063 CAGGTAGCAGAAGAGGTGGATGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085127269 11:74010383-74010405 TGAGAAGCAGAAGGGAGGGAAGG + Intergenic
1085255836 11:75172469-75172491 GGGGAAGAAGAAGTAGGGGATGG - Exonic
1085293731 11:75418461-75418483 TGGGTGGCAGCAGTGGTGGTAGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085739448 11:79066288-79066310 TAGAAGGCAGAAGAGGTGGATGG + Intronic
1086644966 11:89209147-89209169 TGGGAAGCACAAGGGGTTGGGGG + Intronic
1086891177 11:92259902-92259924 TGGAAAGCAGAAGATGTGGCTGG + Intergenic
1087364228 11:97198656-97198678 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1087393822 11:97571320-97571342 TGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1088019412 11:105101353-105101375 TGGGAGGAAAAAGTTGTGGAAGG - Intronic
1088245432 11:107813768-107813790 TGGGAGGCTGAGGTGGAGGATGG - Intronic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1088435811 11:109812103-109812125 TAGGAAGCAGAATGGATGGATGG + Intergenic
1088646058 11:111917441-111917463 TGGGAACCAGGCGTGGTGGGAGG + Intronic
1089084119 11:115802441-115802463 TTGGATGCACAAGTGGTGGATGG + Intergenic
1090466876 11:126942813-126942835 TGGAAAGCAGAAATCCTGGAAGG - Intronic
1091077069 11:132629129-132629151 TGGGAAGCAGAAGAAGTGAGAGG - Intronic
1091113460 11:132993065-132993087 TGGGAAGCAGGAGCTGGGGAGGG - Intronic
1091193283 11:133711924-133711946 TAGGGAACAGAAGTGGTGGTGGG - Intergenic
1091356866 11:134944114-134944136 TGGGAAGCAGGAGAAGGGGAGGG + Intergenic
1091686628 12:2567130-2567152 TGGAAAGCAGCTGTGGAGGATGG - Intronic
1091955410 12:4637376-4637398 TGGGAAGCAGCTTTGGTTGAGGG + Intronic
1092078692 12:5694785-5694807 TGGGAGGCAGCATTGGTGGCAGG + Intronic
1092208399 12:6630863-6630885 CGGGAAGCAGAAGTGTGGGATGG - Intronic
1092709046 12:11315062-11315084 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1093004349 12:14035657-14035679 CGGGAAGCACAAGGGGTGGGGGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093397526 12:18701655-18701677 TGGGAAGAAGAAGTGGCAGATGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094693893 12:32797370-32797392 TGGGAGGCAGAAGTGGCAGTGGG + Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1095974692 12:47931234-47931256 TGGGGAGTAGAAGTGGGGAAAGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096478028 12:51920632-51920654 TGGGAAGAAGATGAGGAGGATGG - Intronic
1096809519 12:54160608-54160630 GTGGAAGGAGAGGTGGTGGATGG - Intergenic
1097084838 12:56459874-56459896 TGGGAGGCTGAGGTGGTGGGAGG - Intronic
1097205208 12:57315279-57315301 TGGGAGGCCGAAGTGGTGGGTGG - Intronic
1097276398 12:57816259-57816281 TGGGAAGCAGAACTCATGGGTGG - Exonic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098151954 12:67555984-67556006 TGGGAAGCACAAGGGGTAGGGGG - Intergenic
1098183260 12:67870140-67870162 TGGGAAGCACAGGGGGTCGAGGG - Intergenic
1098256508 12:68621857-68621879 TGGGAAGCAGAACTAGTCAAAGG - Intronic
1098993924 12:77096391-77096413 TGGGAAGCACAAGGGGTCAAGGG - Intergenic
1099227418 12:79986430-79986452 TGAGAAGGGGAAGAGGTGGATGG - Intergenic
1099310244 12:81011284-81011306 TGTGAGGCCGAGGTGGTGGAGGG + Intronic
1099317447 12:81102443-81102465 CAGGAAGCATAAGTGGGGGAGGG + Intronic
1099522445 12:83681419-83681441 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1100375172 12:94008265-94008287 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1100773549 12:97950114-97950136 TGGGAAACAGGGGTGGGGGATGG + Intergenic
1100865740 12:98854752-98854774 TGAGAAGCAGAATTAGGGGAAGG + Intronic
1101102123 12:101404943-101404965 TGGGAGGCAGAGGTTGTGGCAGG - Intronic
1102363579 12:112311354-112311376 TGGGAGGCTGAGGTGGTGGGAGG + Intronic
1102392026 12:112557032-112557054 TGGGAAGCAGAGGTGGGAGGAGG - Intergenic
1102757622 12:115355937-115355959 TGGGAAGCAGTAGAGATGGGTGG - Intergenic
1102928714 12:116846378-116846400 TGGGAGGCTGAAGTGGTGGGAGG - Intronic
1102992835 12:117327293-117327315 TGGGAGGCAGAGGTGGTGCTTGG + Intronic
1103108511 12:118253116-118253138 AGGGAAGCAGAAGTAATGGTAGG + Intronic
1103359346 12:120344601-120344623 TGGGAGGCTGAGGTGGAGGATGG + Intronic
1103523121 12:121549404-121549426 AGGGAAGGAGATGAGGTGGAAGG + Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104110610 12:125700756-125700778 TGGGAGGCAGAAGAGGAGGAGGG + Intergenic
1104155502 12:126127304-126127326 TGGGAGGCTGAGGTGGAGGATGG + Intergenic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104341150 12:127950126-127950148 TGGGATGCTGAAGTGATGGCTGG + Intergenic
1104402062 12:128484502-128484524 TAGGAGGCAGAAGTCTTGGAGGG - Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105209139 13:18247647-18247669 TGGGAAGCAGACCAGGTGGCTGG + Intergenic
1105348289 13:19593722-19593744 AAGGAAGCAGAAGAGGGGGAGGG - Intergenic
1105683281 13:22751951-22751973 TGGCAAGAAGAAGTGGTCGGTGG - Intergenic
1105770888 13:23610721-23610743 TGGGAAGGAGAGGTGGAGGGAGG + Intronic
1106159195 13:27185341-27185363 TAGGTAGCAGCAATGGTGGAGGG - Intergenic
1106917047 13:34526938-34526960 TGGGAAGGAGTAGTGAGGGAAGG + Intergenic
1107065332 13:36208559-36208581 TGGGAAGTATATGGGGTGGAGGG - Intronic
1107340144 13:39396685-39396707 TGGGAGGCTGAGGTGGTGGGAGG + Intronic
1108013095 13:46041829-46041851 TTGGAAGCAGATGTGATGGCTGG + Intronic
1108716312 13:53081530-53081552 TGGACAGCAGAAGTGGGGAAAGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110570970 13:77003059-77003081 TGCGAAACTGAGGTGGTGGAAGG + Intronic
1110818512 13:79887238-79887260 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111411646 13:87884880-87884902 TGGGAAGCAGAATTGGGCAAGGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112176199 13:97027807-97027829 TGGAAAGCAGAAGAGGAAGAAGG - Intergenic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1112354387 13:98661694-98661716 TTGGAGGCAGAAGAGGAGGACGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115232242 14:31173598-31173620 TTGGAATCTGCAGTGGTGGATGG + Exonic
1115315032 14:32016355-32016377 TGGGAGGTAGAAGTAGGGGATGG + Intronic
1116019380 14:39442013-39442035 TGGGAAGCAGCAGTGGGGCTGGG + Intergenic
1116792705 14:49356776-49356798 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1116950676 14:50875853-50875875 TGGGAAGCAGAGGCAGTAGAGGG - Intronic
1117114594 14:52496713-52496735 TGGGAGGCTGAGGTGGTGGGAGG - Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117202653 14:53408372-53408394 AGGGAGGCAGGAGTGGGGGAGGG - Intergenic
1117202675 14:53408429-53408451 AGGGAGGCAGGAGTGGGGGAGGG - Intergenic
1117494866 14:56293165-56293187 TGCTAATAAGAAGTGGTGGATGG + Intronic
1117516742 14:56509436-56509458 TGAAAAGCAGAAGTGTTGTATGG + Intronic
1117812145 14:59558546-59558568 AGGAAAGCAGAAATGGTAGATGG + Intronic
1118275046 14:64378777-64378799 TGGGAGGCTGAGGTGGAGGATGG + Intergenic
1118806922 14:69246002-69246024 TAGGAAGCAGAAGTAGGGGCCGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119262084 14:73243941-73243963 TGGGAAGCAGATGTGATGGCTGG - Intronic
1119740665 14:77011999-77012021 TGAGTAGCAGGAGGGGTGGAAGG - Intergenic
1120615411 14:86698058-86698080 TGGGAAGCTGAAGTGAAGTATGG + Intergenic
1120973060 14:90225237-90225259 TGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1122293814 14:100693921-100693943 GGGTACGCAGAAGGGGTGGACGG - Intergenic
1122859126 14:104574433-104574455 TGGGAAGCAGAGCTGGTGTCTGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1124149893 15:27167969-27167991 AGGCGAGCAGAAGTGATGGAGGG + Intronic
1124461859 15:29899485-29899507 TGGGCAGAAGATGTGGTGGCAGG + Intronic
1124656636 15:31514652-31514674 TGGGGAGCAGAGGTGGGAGATGG - Intronic
1124719423 15:32098577-32098599 TGGAAAGCAGAGCTGGTGGTGGG + Intronic
1125292532 15:38165760-38165782 TGGGTAGCAGAAGTTGCAGATGG + Intergenic
1125711561 15:41791182-41791204 TGGGATTGAGAAGTGGGGGAAGG + Intronic
1126163061 15:45631803-45631825 TGGGAAGAAGAAGTGATAGGAGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128137178 15:65272564-65272586 TGGGTAGTAGAGGTGGGGGAAGG - Intronic
1128306285 15:66600997-66601019 TGGGAAGCAGAAGAGGGAAATGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128382691 15:67125094-67125116 TGGGAAGCAGTTGTGTTGAATGG + Intronic
1128447407 15:67776211-67776233 TTGGAGGCAGAAGTGGAGGTGGG - Intronic
1128971595 15:72111889-72111911 TGGGAGGCAGAGGTGGAGGTAGG - Intronic
1129686503 15:77689163-77689185 GGAGAAGCAGCAGAGGTGGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132630596 16:915446-915468 TGGGAATCAGAGGTTGAGGAGGG + Intronic
1133247686 16:4460109-4460131 TGGGACGCTGAGGTGGAGGATGG - Intergenic
1133402393 16:5498214-5498236 TGGGAAGCAGAAGTTGCAGTGGG - Intergenic
1134112703 16:11525042-11525064 TGGGAAGCTGAGGTGGGTGATGG + Intergenic
1134503884 16:14790024-14790046 TGGGAGGCTGAGGTGGTGGGAGG + Intronic
1134576688 16:15338875-15338897 TGGGAGGCTGAGGTGGTGGGAGG - Intergenic
1134725752 16:16417614-16417636 TGGGAGGCTGAGGTGGTGGGAGG + Intergenic
1134805123 16:17117880-17117902 GGGTATGCAGAAGTGGGGGAAGG - Exonic
1134941682 16:18294244-18294266 TGGGAGGCTGAGGTGGTGGGAGG - Intergenic
1135068916 16:19335341-19335363 CAGGAACCAGAAGGGGTGGACGG + Intergenic
1135125551 16:19806582-19806604 TGGGAACCCGAGGTGGAGGATGG + Intronic
1135185393 16:20311145-20311167 TGGAAAGCAGAAGTGCTGAAGGG + Exonic
1135631096 16:24036018-24036040 TGGGAAGGAGGAGGGTTGGAGGG + Intronic
1135992630 16:27227263-27227285 TGGGAGGCAGAAGTGCTGGGAGG - Intronic
1135992633 16:27227279-27227301 TTGGAGGCAGAAGTGCTGGGAGG - Intronic
1136091705 16:27925390-27925412 TGGGAGGGAGGAGGGGTGGAAGG + Intronic
1137724637 16:50648834-50648856 TGGAAAGCAGATGTGATGGCTGG + Intergenic
1137750215 16:50855921-50855943 TGGCAAGCAGAACTGGCAGATGG - Intergenic
1138477543 16:57280984-57281006 TGGGAAACAGAAGGGTTTGATGG + Intronic
1139229054 16:65264747-65264769 AGGGAAGCAGAAATTGTGGCTGG - Intergenic
1139438979 16:66954649-66954671 TGGGAGGCTGAGGTGGGGGATGG - Intergenic
1139489274 16:67278069-67278091 TGGGCAGCAGAAGGGGAGGGAGG + Exonic
1139677854 16:68537637-68537659 CGGGAAGCAGAGGTTGTGGTGGG - Intronic
1140195421 16:72850920-72850942 TGGGAAGCAGATGGGGTTGGGGG + Intronic
1141552487 16:84815512-84815534 TAGGAAGTAGAAGTGGGAGATGG + Intergenic
1142103751 16:88291062-88291084 AGGGAAGCAGAGGTGCCGGACGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142466499 17:140330-140352 TGGGCAGCTGAAATGCTGGAAGG - Intergenic
1142663056 17:1444582-1444604 TGGGAAGCCGAAGCGGGGGGGGG + Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143333680 17:6157075-6157097 TAGGGAGCAGAAGTGAGGGACGG + Intergenic
1143353961 17:6310757-6310779 AGAGAATCAGAAGTGGAGGAGGG - Intergenic
1143374975 17:6462019-6462041 TGGGTAGGAGTAGGGGTGGAGGG - Intronic
1143524351 17:7463506-7463528 GGGGCAGTAGCAGTGGTGGAGGG - Exonic
1143698620 17:8640021-8640043 TGGAAAGAAGAAGAGCTGGATGG + Intergenic
1143724879 17:8837952-8837974 TGGGCAGGAGATGGGGTGGAAGG + Intronic
1143789309 17:9281056-9281078 CGGGAAGAAGTAATGGTGGAGGG + Intronic
1144171540 17:12664135-12664157 AGGGAAGCAGAAGGTGGGGAAGG + Intergenic
1144217583 17:13069973-13069995 TCGCAGGAAGAAGTGGTGGAGGG + Intergenic
1144556194 17:16285059-16285081 TGGGAGGCTGAGGTGGTGGGAGG - Intronic
1144819170 17:18059411-18059433 TGGGAAAAGGATGTGGTGGAGGG - Intronic
1145249272 17:21288441-21288463 TGAGGAGCAGAGGTGGTGCAGGG + Intronic
1145393953 17:22479155-22479177 TGGGAGGCCAAAGTGGTGGGTGG + Intergenic
1145816539 17:27798890-27798912 AGGGAAGCAGAGGTGAGGGAAGG + Intronic
1145896364 17:28460011-28460033 TGGGAAGCAGAAGTTGCAGTGGG + Intronic
1146749076 17:35361237-35361259 TGGGAAGCAGTAGTGATGCAAGG + Intronic
1147246172 17:39122432-39122454 TGGGATGCAGATGTGATGGTGGG + Intronic
1147392862 17:40121415-40121437 TGGGGAGGAGAGGGGGTGGAGGG + Intergenic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1147832661 17:43307685-43307707 TGGGAGGCAGAGGTTGTGGTCGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148492003 17:48029226-48029248 TGGCAAGGAGAAGGGGCGGAGGG - Intronic
1148645612 17:49218192-49218214 TGGGAAGGGGAAGAGGGGGAAGG + Intronic
1148785821 17:50145767-50145789 AGGGGAGCAGGAGGGGTGGAAGG + Intronic
1148788234 17:50156873-50156895 TGGGAGGCAGAAGAGGGGAATGG - Intergenic
1148852704 17:50562395-50562417 TGAGAACAAGATGTGGTGGAGGG + Intronic
1148906493 17:50915598-50915620 TGGGAGGCAGAAGTTGTGGTGGG - Intergenic
1149093901 17:52817483-52817505 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1149152963 17:53592039-53592061 TGGGAGGCTGAAGTAGTGGGTGG - Intergenic
1149197009 17:54133114-54133136 TGGGAAGCACAAGCGGTCAAGGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150427289 17:65086739-65086761 TGGGAAGGGGAAGGGGGGGAGGG - Intergenic
1150710402 17:67526243-67526265 TGGGACGCAGCAGTTGGGGAAGG + Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151391491 17:73790423-73790445 TGGGGAGGAGGAGTGATGGAGGG - Intergenic
1151465936 17:74285235-74285257 TGGGGAGCTGCAGTGATGGATGG - Intronic
1151529911 17:74697559-74697581 GGGGAGGGAGAAGTGTTGGAGGG + Intronic
1151677399 17:75605728-75605750 TGGGAGACAGAAGGGCTGGACGG + Intergenic
1151975426 17:77481380-77481402 GGGGAGGCAGATGTGGTGCAGGG + Intronic
1152211791 17:79006302-79006324 AGGGAAGCAGAAGAGCCGGAGGG - Intronic
1152630634 17:81409332-81409354 TGGGAGACAGAAGTGGGGGTGGG + Intronic
1152789830 17:82273101-82273123 TGGGGAGCGGACGTGGGGGAGGG - Intronic
1153008362 18:515561-515583 TGGGAGGCAGAAGTGATGGCAGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154042043 18:10865600-10865622 TGGGAAGAAGGAGTGGAGGTAGG + Intronic
1154446349 18:14438721-14438743 TGGGAAGCTGCAGTGGAGGTGGG - Intergenic
1154497799 18:14975187-14975209 TGGGAAGCAGGAGAAGGGGAGGG - Intergenic
1154949238 18:21192005-21192027 TGTGGAGCAGAAGTGGTCAATGG + Intergenic
1154967702 18:21376360-21376382 TGGGAAGCTGAGGTGGTGGGTGG - Intronic
1155107551 18:22682631-22682653 TGGGAAGAAGTGGAGGTGGAAGG - Intergenic
1155697221 18:28697815-28697837 GGGGAAGGAGAAGGGGTTGAGGG + Intergenic
1156141878 18:34122222-34122244 TGGGGAGCAGAAGAGATAGATGG + Intronic
1156253571 18:35375195-35375217 TGGGAAGCCGAGGTGGGAGATGG + Intronic
1156261633 18:35449757-35449779 TTGGAAGCAGAAGTTGGAGAAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157325054 18:46663009-46663031 AGGGGGGCAGAAGTGGTTGAAGG - Intergenic
1157804089 18:50645089-50645111 TGGCAGGGAGAACTGGTGGAAGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158714565 18:59866547-59866569 TGGGAGGCAGAGGTGATGGGGGG - Intergenic
1159078105 18:63704077-63704099 AGGGAAGCAGAACTTATGGAAGG - Intronic
1159408664 18:68040644-68040666 TGGGAGGCAGAAGTCGCGGTGGG - Intergenic
1159973990 18:74687437-74687459 TGGGAAGCGCAGGTGGCGGATGG + Intronic
1160145640 18:76361898-76361920 TGGGAAGCAGGCTTGGCGGAGGG - Exonic
1160247073 18:77167526-77167548 TGGGAGGCAGAAGTCCTGCAGGG + Intergenic
1160287491 18:77558434-77558456 TGGGAGGCAGAGGTGGAGGTAGG - Intergenic
1160295967 18:77637298-77637320 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1160826765 19:1083812-1083834 TGGGAAGCGGAGGTTGTGGTGGG - Intronic
1161645884 19:5453176-5453198 TGGGAGGCAGATGTGATGGCTGG + Intergenic
1161782726 19:6304129-6304151 TGGGAGGCTGAGGTGGAGGATGG - Intergenic
1162150906 19:8645018-8645040 TGGGAGGCTGAGGTGGGGGATGG - Intergenic
1162836813 19:13325090-13325112 GGGGAAGAAGAAGAGGAGGAAGG - Intronic
1162933662 19:13969800-13969822 TGAGAAGCACATGAGGTGGAAGG + Intronic
1163088463 19:15000947-15000969 TGGGAAGAAGAACTGTTGAAAGG - Intronic
1163676594 19:18658410-18658432 AGGGAAGCAGAAATGGTGGCAGG - Intronic
1163718524 19:18886477-18886499 AGGGAGGCAGAGGTGGTGGCAGG + Intronic
1163775539 19:19215181-19215203 TGGGAAGGAGAACTGGGGAAAGG + Intronic
1163984322 19:20930844-20930866 TGGGAGGCAGAGGTTGTGGTGGG - Intronic
1164062762 19:21689826-21689848 TGGGAACAAGGAGTGGTGGTGGG + Intergenic
1164227366 19:23257598-23257620 TGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1165168150 19:33871762-33871784 TGGGAGGAAGAATGGGTGGATGG - Intergenic
1165547500 19:36553378-36553400 TGGGAGGCCGAGGTGGTGGGTGG - Intronic
1166041560 19:40205887-40205909 TGGGAAGGAGAGGCGGTGGCTGG - Intronic
1166089738 19:40500771-40500793 TGGGAGGCAGAGGTTGTGGTGGG + Intronic
1166735706 19:45083203-45083225 TGGGAAGCTGAACTGGGGGTGGG + Intronic
1166959510 19:46489213-46489235 AGGGAGGCTGAAGTGGTGGGAGG + Intronic
1167635674 19:50653896-50653918 TGGGAACCAGGAGGGGTAGATGG + Intronic
1167694246 19:51004943-51004965 TGGTAAACAGAAGTCGGGGACGG + Intronic
1167761883 19:51454868-51454890 TGGGAAGGAGAAGAGGGGAATGG - Intronic
1167822113 19:51937801-51937823 TGGGAGGCAGAGGTTGTGGTAGG - Intronic
1167828908 19:52001688-52001710 TGGGAAGAAGGAGTGATGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168170571 19:54585728-54585750 TGGGAAGCACAAGGGGTCGGAGG - Intronic
1168614285 19:57825364-57825386 TGGGAGGCAGAGGTTGTGGTGGG - Intronic
925245350 2:2377701-2377723 AGGGAAACAGAAGGGGTGGGAGG + Intergenic
925295741 2:2775573-2775595 TGTGTAGGTGAAGTGGTGGAGGG + Intergenic
925348679 2:3187345-3187367 CTGGAAGCAGAAATGCTGGAGGG + Intergenic
925944395 2:8847172-8847194 TTGGAGGCAGGGGTGGTGGATGG + Intergenic
927502807 2:23593594-23593616 TGCGGAGGAGAAGTGATGGAAGG + Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927921014 2:26971506-26971528 CGGGGAGTAGAAGTAGTGGAGGG + Intronic
927927656 2:27024837-27024859 TGGGAAGCAGCAGCGTTGGGAGG + Intronic
927993025 2:27461555-27461577 TGGGAGGCAGAAGGGTAGGAAGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928462620 2:31489270-31489292 CAGGAAGCACAAGGGGTGGAGGG + Intergenic
928497232 2:31846169-31846191 TGGGAGGCAGAAGTTGTAGTGGG - Intergenic
928607731 2:32959205-32959227 TGGGAAGATGAATTGGAGGAAGG + Intronic
929034454 2:37677517-37677539 AGGGAAGCAGAAGTTGGGGGCGG - Intronic
929094128 2:38247715-38247737 TGGGCAGCTGGGGTGGTGGATGG - Intergenic
929473713 2:42223043-42223065 TGGGAGGCCGAAGGGGTGGAGGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930008644 2:46917236-46917258 TGGGAGGCGGAGGTGGTGGGAGG - Intronic
930266829 2:49210081-49210103 TGGGAAGTACAAGGGGTCGAGGG + Intergenic
930353092 2:50282146-50282168 TAGGAAGCAGAAGATGTGGCTGG + Intronic
930617071 2:53604650-53604672 AGAGAAGGAGAAGTGGTTGACGG + Intronic
930659589 2:54040501-54040523 TGGAAAGCAGAAGAGGTACAAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931594475 2:63926694-63926716 TGGGAAGCACAAGGGGTCGGGGG + Intronic
932146431 2:69322892-69322914 TGGGAAGATGAAGTGGAGGCGGG - Exonic
932298134 2:70643567-70643589 TGGGAGGCTGAGGTGGTGGGAGG - Intronic
932414962 2:71568094-71568116 TGGGAGGCAGAGGTGGGGGCTGG - Intronic
932601902 2:73133412-73133434 AGGGAAGGAGAGATGGTGGAGGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933260150 2:80123358-80123380 TGGGCTGCAGAAGTGATGAAAGG + Intronic
933740794 2:85532534-85532556 TGGGAGGCAGAGGTTGTGGTGGG - Intergenic
933766449 2:85712528-85712550 GTGGAACCAGAAGTGGAGGATGG + Intergenic
933969681 2:87460318-87460340 TGGAATGCAGAAGTGATGGCAGG - Intergenic
934058953 2:88276239-88276261 TGGGAGGCAGAAGTTGCGGTGGG - Intergenic
934531566 2:95092913-95092935 CGGGAAGCACAAGTGGTCCAGGG + Intronic
934604378 2:95682890-95682912 TGGGAAGCAGGCGTGGGGGTCGG + Intergenic
934747198 2:96767173-96767195 TGGGAGACAGAAGTGCTGCAAGG - Intronic
935147723 2:100407532-100407554 TGCCATGCAGAAGTGATGGATGG - Intronic
935181078 2:100691797-100691819 TGGGAAGCAGAAGTGCAAGGAGG + Intergenic
936005745 2:108885759-108885781 TGGGAATCATGAGTGGTGGGAGG - Intergenic
936032073 2:109080357-109080379 TGGGATGCAGAAGGACTGGAAGG + Intergenic
936324104 2:111490179-111490201 TGGAATGCAGAAGTGATGGCAGG + Intergenic
936601585 2:113901282-113901304 TGGGAGGCAGAGGTTGTGGTGGG + Intronic
936733458 2:115411087-115411109 TGGGAGGCCGAGGTGGTGGGTGG + Intronic
937062497 2:118990969-118990991 GGGGAAGCAGCAGCCGTGGATGG - Intronic
937198291 2:120179889-120179911 TGGGCAGCAGTGGAGGTGGAGGG + Intergenic
938238350 2:129724044-129724066 TGGGAAGCAGAATTGGAGCAGGG - Intergenic
938252739 2:129828155-129828177 GGAGCAGCAGAAGTGGGGGACGG + Intergenic
938921282 2:135997508-135997530 AGAGAAGCAGAACTGATGGAGGG + Intergenic
939055525 2:137360422-137360444 TGGGAAGCAGGAGGGGTTGGGGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939441372 2:142254716-142254738 AGGGAAGCAGAAATGGAGGCTGG - Intergenic
940362470 2:152811210-152811232 TGGAAGGCCGAGGTGGTGGATGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941181750 2:162267686-162267708 TGGGAAGCAGGAGGGAAGGAAGG - Intronic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
941587001 2:167372456-167372478 GGGGGAATAGAAGTGGTGGAAGG - Intergenic
941797062 2:169610963-169610985 TGGGAAGCCGAGGTGGCGGGTGG + Intronic
942029393 2:171943906-171943928 TGGGAGGCTGAAGTGGAGGATGG + Intronic
942361185 2:175173350-175173372 TGGGAAGAAGAGATGATGGAAGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942983793 2:182114444-182114466 TGGGATGCAGGAGAGGTGTAGGG + Intronic
943092368 2:183390224-183390246 GGGGAAGCTGAAGTGGTGGGAGG + Intergenic
943583488 2:189711802-189711824 TGGGAAGCACAAGGGGTTGGGGG + Intronic
943694440 2:190909474-190909496 TGGTTACCAGAAGTGGGGGAGGG - Intronic
944033908 2:195269642-195269664 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946414194 2:219531411-219531433 TTGGATGCAGGAGTGATGGAAGG + Intronic
946596339 2:221309818-221309840 TGTGCAGCAGCAGTGGTGCACGG - Intergenic
946669622 2:222088902-222088924 TGGGAAGTGGCAGAGGTGGAAGG - Intergenic
947309160 2:228781390-228781412 TGGGAGGCAGAAGTCTTAGACGG - Intergenic
947345247 2:229183703-229183725 TGGGAAGCAGAAATGATGGTAGG - Intronic
947412226 2:229852879-229852901 TGGGAACCAGTAGTGGTTCATGG - Intronic
947641300 2:231709129-231709151 TGGGAATCGGAAGTGCTGGGGGG + Intronic
947829791 2:233130895-233130917 TGGGAAGCGGATGGGGTGGGAGG + Intronic
948454607 2:238099002-238099024 GGGGAAGCAGGAGGGGTGGTGGG - Exonic
948948713 2:241235321-241235343 TGGGACCCAGAAGTGGTGAGAGG + Intronic
949005500 2:241644572-241644594 TAGGAATCAGAAGTGTTGGCCGG + Intronic
1168798606 20:629209-629231 TGGGAGGCAGAGGAGGAGGACGG + Intergenic
1169012798 20:2264625-2264647 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1169153785 20:3312060-3312082 TGGGAGGCAGAGGTTGTGGTGGG - Intronic
1170430383 20:16270384-16270406 TGGGGAGCAGCTGTGGTGCAGGG - Intergenic
1171026249 20:21632997-21633019 TGGGAAGCAGAAATGGCTGCAGG + Intergenic
1171087586 20:22252256-22252278 TGGTAAGAACAAGTGGGGGAAGG - Intergenic
1171145550 20:22778348-22778370 TGGGGAGAAGAATTGTTGGAGGG - Intergenic
1171204292 20:23267004-23267026 TTGGAAGAAGAACTGGTGAAAGG + Intergenic
1171290312 20:23979360-23979382 TGGGAAGCAGACCAGGTGGCTGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172244184 20:33434320-33434342 AGGGGAGGAGGAGTGGTGGAAGG - Intronic
1172379840 20:34480269-34480291 TGGGAGGCAGAGGTTGTGGTGGG - Intronic
1172388901 20:34552842-34552864 TGTGGAGCAGGAGTGGTGGAAGG + Intronic
1172605015 20:36208217-36208239 AGGGAACCAGAAGTGAAGGATGG - Intronic
1172628586 20:36363248-36363270 AGGGAACCAGAGGTGGTGCAGGG + Intronic
1172660971 20:36568566-36568588 TGGGAGGCTGAGGTGGAGGAAGG - Intergenic
1172872260 20:38143119-38143141 TGGGATGAAGGAGTGGAGGAAGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173543893 20:43877073-43877095 TGGGAAGCACAAGGGGTCCAAGG - Intergenic
1173741692 20:45406558-45406580 CGGGAGGCGGAAGTGGGGGAGGG - Intronic
1173824414 20:46038300-46038322 TGGGAGGCTGAACTGGTGGGGGG - Intronic
1175277314 20:57780988-57781010 TGGAAAGAAGAATAGGTGGATGG - Intergenic
1176112679 20:63417748-63417770 TGGGAAGCAGACGTCGGGGCTGG - Intronic
1176425776 21:6547491-6547513 TGGGAAGCAGGAGTGAGTGAGGG - Intergenic
1177101867 21:16907928-16907950 TGGAAAGGAGGAGTGGTGGGGGG + Intergenic
1177245046 21:18512362-18512384 TGGGCAGCAGGAGTGATTGAGGG - Intergenic
1177287041 21:19065057-19065079 TGGGAAGCAGCAGTGGTTCCAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178041827 21:28647786-28647808 TGGAAAGGAGAGGTGGAGGAGGG - Intergenic
1178211580 21:30540460-30540482 TGGGAGGCAGAAGTTGTAGTGGG - Intergenic
1178310956 21:31529650-31529672 TGGGAAGGAGCAATGCTGGATGG - Intronic
1178546019 21:33493644-33493666 CTGGAAGCAGAAGAGGGGGATGG - Intergenic
1179141235 21:38727275-38727297 TGGGAAGCGGTGATGGTGGAAGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179389832 21:40977712-40977734 TGGGGAGCAGAGTTGGTAGATGG - Intergenic
1179424944 21:41268635-41268657 TGGGAGGCTGAGGTGGTGGGAGG + Intronic
1179495584 21:41769430-41769452 TGGGAAGGAGGAGTTGGGGAAGG + Intergenic
1179701267 21:43155808-43155830 TGGGAAGCAGGAGTGAGTGAGGG - Intergenic
1179780206 21:43694731-43694753 TGGGAGGCAGCAGTGGAGAAGGG - Exonic
1180540981 22:16447404-16447426 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1180767116 22:18351650-18351672 TGGGAAGCAGACCAGGTGGCTGG - Intergenic
1180779195 22:18510729-18510751 TGGGAAGCAGACCAGGTGGCTGG + Intergenic
1180811914 22:18768049-18768071 TGGGAAGCAGACCAGGTGGCTGG + Intergenic
1181198069 22:21202293-21202315 TGGGAAGCAGACCAGGTGGCTGG + Intergenic
1181401676 22:22653511-22653533 TGGGAAGCAGACCAGGTGGCTGG - Intergenic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1181647873 22:24243589-24243611 TGGGAAGCAGACCAGGTGGCTGG + Intronic
1181649895 22:24253001-24253023 TGGGAATCAGAAGAGGTGGCAGG - Intergenic
1181703634 22:24634608-24634630 TGGGAAGCAGACCAGGTGGCTGG - Intergenic
1181707483 22:24657745-24657767 TGGGAATCAGAAGAGGTGGCAGG + Intergenic
1182344161 22:29648688-29648710 TGGGAGGCAGAAGTTGTAGTGGG - Intronic
1182888801 22:33798948-33798970 TGGGATGCAGTAGTGTTGGGTGG - Intronic
1183108054 22:35628729-35628751 TGGGAAGAAGAAGAGGAGGTGGG + Intronic
1183700363 22:39447733-39447755 CTGGGAGGAGAAGTGGTGGAGGG + Intergenic
1185007614 22:48291520-48291542 TGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1185109271 22:48891925-48891947 TGGGATGCAGATGTGATGGCAGG - Intergenic
1203228738 22_KI270731v1_random:92544-92566 TGGGAAGCAGACCAGGTGGCTGG - Intergenic
949925190 3:9035574-9035596 TGAGCAGCAGAAGAGATGGAAGG - Intronic
949996250 3:9619651-9619673 TGGGAAGCAGAAGCAGTGCTGGG + Intergenic
950160202 3:10754813-10754835 TGGGCACAAGAAGTGGTGGGGGG - Intergenic
950565353 3:13766706-13766728 TGGGAAGCAAGAGGAGTGGAGGG - Intergenic
950624276 3:14233044-14233066 AGAGGAGGAGAAGTGGTGGATGG + Intergenic
950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG + Intronic
951183215 3:19682739-19682761 GGGGAAGCACAAGGGGTTGAGGG - Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951439544 3:22707314-22707336 GGGGAAGCACAAGGGGTGGGGGG - Intergenic
951465606 3:22997544-22997566 TGGGCAGGGGAAGTGGGGGAGGG + Intergenic
951610848 3:24491632-24491654 TGGGCTGCAAAAGTGGTGGTTGG - Intronic
951730751 3:25808017-25808039 TGGGAAGTAAAAGAAGTGGATGG - Intergenic
951734555 3:25849956-25849978 TGGTATGCAGAAGTGCTGGTGGG - Intergenic
951839833 3:27022606-27022628 TAGGAAGCAGAAGTGGGAGAAGG + Intergenic
952206344 3:31184562-31184584 TGGGAAGCAGAATTAAGGGAAGG - Intergenic
952422393 3:33143912-33143934 TGGGGAGGACAGGTGGTGGAGGG + Exonic
952481315 3:33764513-33764535 TGGGAAGCTGAGGGGGAGGATGG + Intergenic
952722436 3:36547036-36547058 TGGGGAGGAGAAGTGGGGAAAGG + Exonic
952743310 3:36755688-36755710 TAGGATGGAGAAGTGGAGGATGG + Intergenic
953780218 3:45862377-45862399 TGGGAAGCAGATCTGTTTGAAGG - Intronic
954145460 3:48632195-48632217 GCGGGAGCAGAAGTGGTGGTGGG + Intronic
954328743 3:49877806-49877828 TGGGAGGCAGAAGTGGGTGAGGG + Intergenic
954786105 3:53093635-53093657 TGAGAGGCTGAAGTGGTGGGAGG + Intronic
954881673 3:53840278-53840300 TGGGAGGCAGAGGTGGAGGTGGG + Intronic
954897848 3:53992184-53992206 AGGTAAGCAGAAGTGTTGCATGG - Intergenic
954991179 3:54841913-54841935 TGGCAAGCCCAAGTGCTGGAAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955965275 3:64382680-64382702 TGGAGAGGAGAGGTGGTGGAGGG + Intronic
956199557 3:66692110-66692132 TGGGGAGCAGGGGTGGAGGAAGG + Intergenic
956534631 3:70261954-70261976 TGGTATGCAGAAGTGCTGGCAGG - Intergenic
956686296 3:71831399-71831421 TGGGCAGCAGAAGTGCTTCATGG - Intergenic
957337550 3:78851048-78851070 TGGGAGGCCGAGGTGGTGGGTGG - Intronic
958085976 3:88807599-88807621 TGGGAGGCAGAGGTGGAGGTGGG - Intergenic
959888488 3:111528385-111528407 AGGGATGCTGAAGAGGTGGAGGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960547499 3:118933064-118933086 GGGGCAGCAGAAGTTGTGAAAGG + Intronic
960574014 3:119211613-119211635 CGGGAGACAGAAGTAGTGGAGGG + Intergenic
960740671 3:120830153-120830175 AGGGAATCAGAAGTGTGGGATGG + Intergenic
960787718 3:121392335-121392357 TGGGAAGCGCAAGGGGTGGGGGG - Intronic
960992379 3:123320374-123320396 TGAGAACCAGAAGTGAAGGAGGG + Intronic
961176028 3:124835617-124835639 TGGGAAGCAGAACATGTGGCGGG + Intronic
961245932 3:125453340-125453362 AGGGGAGAAGAAATGGTGGAGGG + Intronic
961602986 3:128075505-128075527 GGGGAAGGAGCAGTGGGGGAAGG - Intronic
961933136 3:130554798-130554820 TGGGAGGCTGCAGTGGGGGAGGG + Intergenic
962902048 3:139769899-139769921 AGAGAAGCAGAAGCAGTGGATGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963564821 3:146916130-146916152 TGGGAAGAAGAAGAAGAGGAAGG + Intergenic
963706862 3:148698565-148698587 TGGGAAGCAGAGGGCGTGGATGG - Intronic
963732574 3:148987323-148987345 GGTGAAGCAGGCGTGGTGGAGGG + Intergenic
964311087 3:155393148-155393170 TGGGAAGTAGGAGTGTTGGTGGG - Intronic
964363714 3:155926340-155926362 TGGGGAGCAAAAGTGTGGGAGGG + Intronic
964718984 3:159753051-159753073 TGAGGAGCAGAAGTGGGGAAGGG - Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
965814348 3:172621322-172621344 TGGGAGGCAGAGGTTGTGGTGGG - Intergenic
966160103 3:176958718-176958740 TGGAATGCAGATGTGGTGGCTGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966931895 3:184680830-184680852 TGGGCTGCAGGAGTGGTGGGGGG + Intronic
967049565 3:185770112-185770134 AAGGAAGCAGAACTGGGGGATGG + Intronic
967405307 3:189109158-189109180 AGGGAAGGAGAAGAGGAGGAAGG + Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
968408645 4:365266-365288 TGGGAAGCACAAGGGGTTGGGGG - Intronic
968623751 4:1616634-1616656 TGCAAACCAGAAGTGGTTGAGGG + Intergenic
968860679 4:3166874-3166896 TGGGAAGCACAAGGGGTCGGGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970245102 4:14053011-14053033 AGGGAAGTAGAACTGATGGAAGG - Intergenic
970718316 4:18955275-18955297 TGAGAAGCAGCAGTGGTAGAAGG + Intergenic
970914975 4:21321961-21321983 AGGGAAAGAGAAATGGTGGAAGG + Intronic
971419462 4:26462160-26462182 TGAAAAGCAGAAGAGCTGGAAGG - Intergenic
972075350 4:35079805-35079827 TGGGAAGCAGTAGTGGGGCCGGG + Intergenic
972416037 4:38841483-38841505 AGGGAGGCTGAAGTGGAGGATGG + Intronic
972472203 4:39417265-39417287 TGGGAGGGGAAAGTGGTGGAAGG - Intronic
972672940 4:41231314-41231336 TGGGAAGCAGAAAGGGTGGGTGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973237682 4:47922990-47923012 TGGGAAGCACAAGGGGTCGGGGG - Intronic
973286758 4:48427130-48427152 TGGGAGGCAGGGGTGGTGGTGGG - Intergenic
973304869 4:48635093-48635115 AGGGAAGAAGCAGAGGTGGAAGG + Intronic
973673626 4:53241582-53241604 TGGGAGGCTGCAGTGGTGGGAGG - Intronic
973772885 4:54222855-54222877 TGGGAAGCTGAAGTGGGAGGAGG - Intronic
973871368 4:55170044-55170066 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
974045341 4:56893789-56893811 AGGGAGGCTGAGGTGGTGGAAGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
975122230 4:70741118-70741140 GGGGAAGGAGAATTGGGGGAGGG + Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975443920 4:74440996-74441018 GCAGAAGCAGAAGAGGTGGAAGG - Intergenic
975452713 4:74548392-74548414 TGGGAATCATAAGTGGATGAAGG - Intergenic
975625182 4:76338436-76338458 TGGGAGGCAGAGGTTGTGGTGGG + Intronic
976192323 4:82499647-82499669 TGGGAAGCGGAAGTTGTGGTGGG + Intronic
976348233 4:84030020-84030042 TCGGAAGCAGGGGTTGTGGAAGG + Intergenic
976549706 4:86380146-86380168 TGGGAGGCAGAGGTTGTGGTGGG + Intronic
976597867 4:86911007-86911029 TGGGAGGCAGAAGTTGTAGTGGG + Intronic
976753854 4:88477533-88477555 GGGGAAGGGGAAGTGGGGGAGGG + Intronic
976848340 4:89515592-89515614 TGGGAAGCAGATGTCGAGAAAGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977346522 4:95823383-95823405 TGAGAAGCAGATGTGATGGCTGG + Intergenic
977546993 4:98395712-98395734 TGGAAAGTATAAGAGGTGGATGG - Intronic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978487794 4:109275923-109275945 TGAGAAGCAAGGGTGGTGGAGGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978759647 4:112342996-112343018 TGGGGAGCTGAAGGGATGGAAGG - Intronic
978802021 4:112764268-112764290 TGGGACGAAAAAATGGTGGAAGG - Intergenic
978889808 4:113811500-113811522 TAGGAAGCAGAAGGTGTGAAAGG - Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979546246 4:121943231-121943253 GTGGAAGAAGCAGTGGTGGAGGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980079613 4:128330103-128330125 TGGGGTGGAGAAGGGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
980940347 4:139268152-139268174 TGGGAAAAAGAAGTGTAGGAAGG + Intronic
981414974 4:144482644-144482666 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984715389 4:182919687-182919709 TGGCAGGCAGAGGAGGTGGAAGG - Intergenic
984890614 4:184489565-184489587 TGGGAAGCCGAGGTGGGTGATGG - Intergenic
985117464 4:186605641-186605663 TGGAATGGAGAAGAGGTGGAGGG + Intronic
985547928 5:519353-519375 TGGGTAGCAGATATGGTGAAGGG + Intronic
986105776 5:4658120-4658142 TGGGAGGCAGAAGGGGAGGATGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986586373 5:9322266-9322288 TTGGAAGGAGAAGAGGTAGATGG - Intronic
987489540 5:18560218-18560240 TGGGAAGCGGACGTTGTGGTAGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988676851 5:33441253-33441275 TGGGTCGGAGAAGTGGGGGATGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988978321 5:36537745-36537767 TAGGAAGCAGGAGTGAGGGATGG - Intergenic
989071049 5:37512325-37512347 TGGGAGGCTGAGGTGGAGGATGG - Intronic
989148109 5:38268931-38268953 TGGGAGGCTGAGGTGGTGGGTGG + Intronic
989250959 5:39314373-39314395 TGGGAGGCGGAAGTTGTGGTGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989978500 5:50613339-50613361 AGGGTAGCAGAAGTGGAAGAGGG - Intergenic
989980138 5:50633671-50633693 TTGCAAGCAAATGTGGTGGAGGG - Intergenic
990284600 5:54288352-54288374 TGGAATGCAGAAGTGATGGCAGG + Intronic
990650979 5:57899232-57899254 TGGGAAGCAGAAGAGTGAGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
990987677 5:61655768-61655790 GTGGAAGCAGGAGTGCTGGAGGG + Intronic
991279284 5:64893023-64893045 TGGAAAGTAGAAGAGGTGAAGGG + Intronic
991580217 5:68147000-68147022 TGGGAGGCAGAGGTTGTGGTGGG + Intergenic
991656067 5:68904930-68904952 TGGGAAGCAGATGTCCTGCAGGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992943603 5:81787911-81787933 TGGGATGCAAAAGTACTGGAAGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993450866 5:88070660-88070682 TGAGAAGCAGTGGGGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994039650 5:95244387-95244409 CGGGAAGCACAAGGGGTGGGGGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995136621 5:108686190-108686212 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995489865 5:112679434-112679456 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
998040124 5:138946355-138946377 TTGGACACAGAAGTGGTGCAAGG + Intergenic
998368559 5:141646685-141646707 TGGGGAGCAGAAGGCGTGGCTGG - Exonic
998476132 5:142423543-142423565 TGGGAAGCCGAGGTGGCGGGTGG - Intergenic
998552106 5:143087721-143087743 TGGGAGGCGGAGGTTGTGGACGG - Intronic
999239662 5:150120216-150120238 TGGGACGGAGAAGTGGTTGTGGG - Intronic
1000068940 5:157721124-157721146 TGGGAAGCAGAAGGGGTCAGGGG + Intergenic
1000266718 5:159645093-159645115 TGGAAAGCAGCAGGGGTGGGGGG + Intergenic
1000332391 5:160216007-160216029 TGGGAAGCCAATGTGGCGGAAGG + Intronic
1000367859 5:160507577-160507599 AGGGAAGCAGAACTGATGGATGG + Intergenic
1000558149 5:162752801-162752823 TGGGAAGCAGAAGTGTCAGAGGG - Intergenic
1000609485 5:163358841-163358863 TGTCAAGCAAAAGTGGGGGAGGG - Intergenic
1000750664 5:165092284-165092306 GGGGCAACAGAGGTGGTGGAGGG + Intergenic
1000808841 5:165835154-165835176 TGGGAGGTAGGAGTGGTGGGTGG + Intergenic
1001155358 5:169268206-169268228 TGCGAAGGAGGAGTGGCGGAGGG + Intronic
1001686800 5:173599449-173599471 TGTAAAGCAGAAGGGGTGGCGGG + Intergenic
1001803082 5:174560117-174560139 TGGGAAGCAGCAGTGGAAGCAGG - Intergenic
1001989011 5:176100544-176100566 TGGGAGGCAGAGGTGGTGGTGGG + Intronic
1002090110 5:176799269-176799291 TGGGAGGTAGAAGACGTGGATGG + Intergenic
1002227859 5:177737592-177737614 TGGGAGGCAGAGGTGGTGGTGGG - Intronic
1002406008 5:179032071-179032093 TGGGAAAAAGAAGAGGAGGAAGG - Intronic
1002880032 6:1242971-1242993 TGGGAAGAAGCAGAGCTGGAGGG + Intergenic
1003135723 6:3433432-3433454 TAGGAAGCAGGAGTGATGGGAGG - Intronic
1003359830 6:5414394-5414416 TGGGCAGAAGAGGTGGTAGAGGG - Intronic
1003562640 6:7195646-7195668 TGGGAAGCAGTGGTAGCGGAAGG - Intronic
1004189583 6:13452030-13452052 TGGGAAGCAGAAAAAGTGAATGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006042692 6:31269306-31269328 TGGGGAGCTGAAGTGGTCGGGGG - Intronic
1006299540 6:33186223-33186245 TGGGAAGGAGTAGGGATGGAGGG - Intronic
1006384257 6:33720546-33720568 TGGGAAGCAGGAGAGGAGAAAGG - Intergenic
1006405682 6:33843537-33843559 GGGGAAGCAGAAGGGGAGGGAGG - Intergenic
1006609638 6:35286433-35286455 TGGGAGGCAGGACTGGAGGATGG + Intronic
1006811070 6:36821020-36821042 GGGGAATAAGAAGTGTTGGAAGG + Intronic
1007835565 6:44671469-44671491 GGGGAACCAGAAGTCATGGAGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009655590 6:66541103-66541125 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1010173575 6:73000633-73000655 TGGGAAGCGGGTGTGGTGGCTGG - Intronic
1010205241 6:73316608-73316630 TGGGAAGCAAAGGTGGAGGCGGG + Intergenic
1010275925 6:73968276-73968298 TGGTAAGCAGAAAAGTTGGAGGG + Intergenic
1010426592 6:75734750-75734772 GGGGAAGGAGGAGAGGTGGAGGG + Intergenic
1011226821 6:85117075-85117097 TGGGGAGCAGGGGAGGTGGATGG - Intergenic
1012589948 6:100968900-100968922 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012848817 6:104423429-104423451 TGACAAGCAGAAGTGATGGAAGG + Intergenic
1013002098 6:106033248-106033270 TGGGAAGCTGAGGTGGTGGTGGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013387380 6:109645266-109645288 TGGGAAGCACAAGGGGTGGGGGG + Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1013421080 6:109967534-109967556 TGGGAAGGAAAAGTGGAGGGGGG + Intergenic
1013589559 6:111608668-111608690 TGGGAGGCTGAGGTGGTGTAGGG - Intergenic
1013628135 6:111957942-111957964 TGGGAGGAAGAAGATGTGGAGGG + Intergenic
1013940431 6:115654704-115654726 GCAGAAGCAGAAGAGGTGGAAGG - Intergenic
1013987555 6:116213826-116213848 AGGTAAGTAGAAGGGGTGGAAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014718415 6:124891452-124891474 TGTGAAGGAGAAGGGGTTGAGGG - Intergenic
1016244024 6:141961991-141962013 TGGGAAGCACAGGTGCTTGAGGG + Intergenic
1016275714 6:142349862-142349884 TAGGTAGCATAAATGGTGGAGGG + Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016528428 6:145030695-145030717 TGGGATGCAGAAGTGATGACTGG + Intergenic
1017198426 6:151726895-151726917 TGGGAAGAAAAAGTGATGGTGGG + Intronic
1017555761 6:155565490-155565512 TGTTAAGTAGAAGTGGTGAAAGG + Intergenic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018220427 6:161572584-161572606 TGGGAGGCAGAGGTTGTGGTGGG + Intronic
1018472043 6:164106080-164106102 TGGGAAGCGTGAGTGGTGCAGGG + Intergenic
1018526015 6:164710579-164710601 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1018632360 6:165832242-165832264 TGGGAGACAGAAGTGGTGGTGGG + Intronic
1019359167 7:595917-595939 TGGGAAGGAGAAAAGGAGGACGG + Intronic
1019381738 7:727505-727527 GGGGAAGCAGTGGTGGTGGGAGG - Intronic
1019572150 7:1718107-1718129 TGGGATGCAGATGTGATGGTGGG - Intronic
1020063790 7:5172037-5172059 TGGGAAGCAAAGGGGGTGGGTGG - Intergenic
1020333326 7:7042015-7042037 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1020344199 7:7145553-7145575 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1021518684 7:21516479-21516501 TGTCAAGCAGAAATAGTGGAAGG + Intergenic
1021736928 7:23648401-23648423 TGGGAAGCAGAGGTGGGAGGAGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022027654 7:26463913-26463935 TTAGAAGCAGAAGTGGGTGATGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022136057 7:27449482-27449504 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1022233791 7:28441438-28441460 TGGGAAGCTGAAGTGAAGGGAGG - Intronic
1022855481 7:34309826-34309848 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1023757319 7:43431847-43431869 TGGGATGAAGAAGGGGTGGGAGG - Intronic
1024181281 7:46897610-46897632 TGGTAAGCAGATGTGGAGAAGGG + Intergenic
1024247847 7:47483855-47483877 TGTGCAGCACAAGTGATGGATGG - Intronic
1025087233 7:56033249-56033271 TGGGAGGCAGAGGTGGAGGCAGG + Intronic
1026149693 7:67777281-67777303 TGGGGAGCAGGTGAGGTGGAGGG + Intergenic
1026342906 7:69449357-69449379 TGGGAGGCCGAAGGGGTGGGGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028260558 7:88658994-88659016 CTGGAGGCAGAAGTGGTGGAAGG + Intergenic
1028437622 7:90822549-90822571 TGGGCAGCAAAAGGAGTGGAGGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029361971 7:100094360-100094382 GGGGAAGCAGAAGAGGGAGATGG + Intronic
1029364854 7:100110167-100110189 TGGGAGGAAGAAATGGGGGAGGG - Intronic
1029446269 7:100614526-100614548 TGGGAGGCTGAAGTGGTGGGAGG + Intronic
1029704797 7:102270581-102270603 CGGGCAGCAGAATTGGGGGATGG - Intronic
1030085324 7:105810863-105810885 AGGGCAGCAGAAGTGGAGGTGGG + Intronic
1030206633 7:106957964-106957986 TGGCAAGGAGAAGTGGTGACTGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030513609 7:110515482-110515504 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1030787328 7:113678364-113678386 TGGAAAGCAGAATTGGAGAAAGG + Intergenic
1030791028 7:113729333-113729355 CAGGAGGCAGAAGTGGGGGAAGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032564450 7:132927362-132927384 TGAGGAGCAGATGTGGTTGACGG - Intronic
1033311435 7:140264767-140264789 AGGGAAGCTGAAATGCTGGATGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034462572 7:151205951-151205973 GGGGAAGCCCATGTGGTGGAGGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1034991560 7:155550862-155550884 TGGGGAGCAGGAGTGTTGGTTGG - Intergenic
1035019311 7:155791350-155791372 TGGGAGGAAGAAGAGGGGGAGGG - Intergenic
1035385933 7:158472853-158472875 TGGGAGGCAGCAGTGGCGGCGGG + Intronic
1035390814 7:158503428-158503450 AAGAAAGCAGAAGAGGTGGATGG + Intronic
1035541613 8:443915-443937 TGGGAAGCAGCAGAGCAGGAAGG + Intronic
1035618627 8:1021732-1021754 TGGGCAGAAGATGTGGTGGGAGG - Intergenic
1035624544 8:1061098-1061120 TGGAAAACAGACCTGGTGGATGG - Intergenic
1035829804 8:2682992-2683014 TGGGAGGCTGAGGTGGGGGATGG + Intergenic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1035954777 8:4064671-4064693 AGGGCAGCAGCAGTGTTGGAGGG - Intronic
1036397484 8:8381561-8381583 TGGGAGGCAGGCGCGGTGGAGGG + Exonic
1036459733 8:8941242-8941264 AGGGAAGCAGCAGTGGCGGGCGG + Intergenic
1036639246 8:10572062-10572084 TGAGAAGGAGAAGGGGTTGAGGG - Intergenic
1036949153 8:13124379-13124401 TGGGAAGCAGAAGTGTTGGGAGG + Intronic
1036966261 8:13301600-13301622 TAGGAAGCAGATGTGCTTGAGGG + Intronic
1037525085 8:19716716-19716738 TGGGAGGCAGAAGTTGTAGTGGG + Intronic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1038403287 8:27302510-27302532 TGGGAGGCTGAGGTGGTGGGAGG - Intronic
1038890815 8:31720962-31720984 TGGGATGCAGAACTGATAGAGGG + Intronic
1039093553 8:33858091-33858113 TGGAAAGCAGAGGTGCTGGTAGG - Intergenic
1039449375 8:37659467-37659489 GGGGAGGAAGAGGTGGTGGATGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039757289 8:40537168-40537190 TGGGAATCAAAAGTGGAGGCAGG + Intronic
1041770956 8:61471967-61471989 TGGGATGCAGAAGGAGTGGATGG - Intronic
1041789424 8:61676369-61676391 TGGAAAAAAGAAGTGGAGGAAGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042308745 8:67358878-67358900 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1042775924 8:72431098-72431120 TAGGAAGCTAAAGTGGTGGAGGG + Intergenic
1043350931 8:79360248-79360270 GGGGAGTCAGAAGTGGGGGATGG + Intergenic
1043938898 8:86174321-86174343 TGGGAAGCAGAAGGGGTGGGGGG - Intergenic
1044350719 8:91162792-91162814 TGGAAAGCAGAGGTGGAGGGAGG - Intronic
1044543517 8:93433902-93433924 TGGAGAGCAGCAGTGGTCGAGGG - Intergenic
1044809090 8:96039050-96039072 TGGGAAGCACAAGGAGTGGGGGG - Intergenic
1045481293 8:102594144-102594166 TGAGGAGCCGAAGTGGGGGATGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045928390 8:107597233-107597255 TAGGAAGCACAAGTGGTCGGGGG - Intergenic
1045965882 8:108023837-108023859 GGGGAGGAGGAAGTGGTGGATGG + Intronic
1045987516 8:108265617-108265639 TGGGAGGCCAAGGTGGTGGATGG + Intronic
1046038226 8:108870871-108870893 GGGGAAGGAGAAGAGATGGAGGG - Intergenic
1046211547 8:111082597-111082619 GGGGAAGCAGAAGTGGATCAGGG - Intergenic
1046509844 8:115187944-115187966 TGGGAATCAGAGGAGGTGGTAGG + Intergenic
1046607881 8:116390910-116390932 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1047824314 8:128556884-128556906 TGAGAGGAAGCAGTGGTGGAAGG + Intergenic
1048274989 8:133059238-133059260 TGGGAAGCAGAAGTGTTCCAAGG + Intronic
1048287388 8:133152398-133152420 TGGGAAGGAAAATGGGTGGATGG - Intergenic
1048991933 8:139765606-139765628 TGGGCAGGTGAAGTGGTGGCAGG + Intronic
1049051827 8:140203822-140203844 TGGGTACCAGGAGTGGTGGAAGG + Intronic
1049228909 8:141472089-141472111 CAGGAGGCAGAAGTGCTGGAAGG - Intergenic
1050016042 9:1235684-1235706 TGGGAAGCAGAGGGGGTAGCTGG + Intergenic
1050107494 9:2180711-2180733 TTGGAAGCAGATGTGGTTAAAGG - Intronic
1050118876 9:2288130-2288152 GGGAAAGCGGAAGTGGGGGATGG - Intergenic
1050287107 9:4114905-4114927 TGGGTGGCAGAACTGGGGGAGGG - Intronic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051211633 9:14751132-14751154 TTAGAAGAACAAGTGGTGGAAGG + Intronic
1052972366 9:34384948-34384970 AGGGATGCAGGAGAGGTGGAGGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053159024 9:35800732-35800754 TGAGAAGCAGATTTGGTGGACGG + Exonic
1055044814 9:71912639-71912661 TGGGAGGCCGAGGTGGTGGGCGG + Intronic
1055676853 9:78672017-78672039 TAGGAAGGGGAAGAGGTGGAGGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056478242 9:86974202-86974224 TTAGAAGAAGAAATGGTGGAGGG + Intergenic
1056527578 9:87457522-87457544 GGAGAAGCAGAAGAGGTGAAGGG + Intergenic
1056917130 9:90755793-90755815 AGGGAAGGACAAGTGATGGAGGG - Intergenic
1057234615 9:93348527-93348549 AGTGAAGGAGAAGGGGTGGAGGG - Intergenic
1057251518 9:93507212-93507234 TGGGAGGCAGGAGTGCTGGGTGG + Intronic
1057457266 9:95226187-95226209 AGGGTAGCAGAATTGGTGGTAGG - Intronic
1057531999 9:95857172-95857194 GGGGCAGCAGAAGTGATGGGGGG + Intergenic
1058792929 9:108469390-108469412 TGGCAAGAAGAAATGATGGAAGG - Intergenic
1058891693 9:109366541-109366563 TGGGAGGCTGAGGTGGAGGATGG - Intergenic
1059065411 9:111078503-111078525 TGGCAAGCAGAAGATGTTGAGGG - Intergenic
1059117238 9:111610604-111610626 TGGGAGGTTGAGGTGGTGGATGG + Intergenic
1059547459 9:115192560-115192582 TGGGAAGTGGGAGTGGAGGAAGG - Intronic
1059634554 9:116158123-116158145 TGGCAAGCAGAGGTGCTGGATGG - Intronic
1060198157 9:121636446-121636468 AGGGAAGCAGACCTGGTGGCTGG + Intronic
1060335682 9:122719481-122719503 TGGGAAGCAGAAATGGGAGTAGG + Intergenic
1060399395 9:123339444-123339466 TGAGAAGCAGCGGGGGTGGAGGG + Intergenic
1060573694 9:124668328-124668350 AGGGTGGCAGAAGAGGTGGAAGG + Intronic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1060907673 9:127322250-127322272 TGGGAAGCAGAGTTGGTGTGGGG - Intronic
1061507480 9:131039588-131039610 TGAGAAGCAGGAGTGGGTGAGGG + Intronic
1061516082 9:131091382-131091404 TGGGGAGCAGAAGGGCTGGGAGG - Intronic
1061697226 9:132385619-132385641 ATGGAAGCAGAAGCGGTGGCAGG - Intronic
1061999530 9:134208897-134208919 TGGGGAGCAGGTGTGGGGGAGGG - Intergenic
1062181388 9:135193017-135193039 TGGGAGGAAGACGTGGAGGATGG - Intergenic
1062217139 9:135395296-135395318 TGGGATGGAGAAGGGGTGAATGG + Intergenic
1185451711 X:284291-284313 TGGGATGGAGAGGTGGTGGAGGG - Exonic
1185478408 X:428724-428746 TGGGAGGCTGAGGTGCTGGACGG - Intergenic
1185581984 X:1216740-1216762 GTAGAAGCAGAAGTTGTGGAGGG - Intergenic
1185858767 X:3559033-3559055 GGGGAAGGAGAAGGGGTTGAGGG + Intergenic
1185871708 X:3670148-3670170 TGGGAAGCAGATGTTGAGCAAGG + Intronic
1185989208 X:4874022-4874044 TGTGTAGCTGAAGTGGTGGTTGG + Intergenic
1186504119 X:10076409-10076431 TAGGAAGGAGAAATGGGGGAAGG + Intronic
1186726969 X:12367619-12367641 GGGGCAGCAGAAGTGTCGGATGG + Intronic
1187313867 X:18173535-18173557 TGGGAAGCACAAGTGGCAGGTGG + Intronic
1187555861 X:20350508-20350530 TGAAAATCAGAGGTGGTGGAGGG + Intergenic
1187789342 X:22932379-22932401 TGGGCAGCAGATGTGTGGGAAGG + Intergenic
1187919365 X:24185823-24185845 TGGGAAGCCGAGATGGGGGAGGG + Intronic
1189211384 X:39286956-39286978 TGGGAGGCTGGAGGGGTGGAAGG - Intergenic
1190301083 X:49058008-49058030 TGGGAAGGAGAAGTAGGGAAGGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191645630 X:63478201-63478223 TAGGAAGCACAAGTGGTCGGGGG + Intergenic
1191757313 X:64607420-64607442 TGGGAAGCACAAGGGGTGAGGGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192857307 X:75025744-75025766 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1192936423 X:75863175-75863197 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192949165 X:75998063-75998085 TGGGAAGCACAAGGGGTAGGGGG - Intergenic
1193001536 X:76568224-76568246 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1193211200 X:78809126-78809148 CTGCAAGCAGAAGTGGTGGTGGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193582956 X:83287140-83287162 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196273983 X:113744739-113744761 TGGGAAACAGAAGAGAAGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196650178 X:118160588-118160610 TGGGAGGCTGAGGTGGAGGATGG - Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198392807 X:136193563-136193585 TGGGAGGCAGAGCTGGTGTAGGG - Intronic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1198892399 X:141412500-141412522 TGGTAAGCAGAAGATGGGGAGGG + Intergenic
1199100763 X:143797005-143797027 TGGGATGCAGCAGTTGAGGAAGG + Intergenic
1199180963 X:144853829-144853851 GGGGAAGCACAAGGGGTCGAGGG + Intergenic
1199796182 X:151200008-151200030 CGGGAAGCACAAGGGGTTGAGGG + Intergenic
1200810518 Y:7479766-7479788 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1201438604 Y:13985504-13985526 AGGGAGGCAGAGGTGGTGGGTGG - Intergenic
1201438652 Y:13985651-13985673 AGGGAGGCAGAGGTGGTGGGTGG - Intergenic
1201445921 Y:14057057-14057079 AGGGAGGCAGAGGTGGTGGGTGG + Intergenic
1201445969 Y:14057204-14057226 AGGGAGGCAGAGGTGGTGGGTGG + Intergenic
1201509685 Y:14745336-14745358 TGTGATGCAGAAGTGTAGGATGG - Intronic
1201652293 Y:16302896-16302918 TAGGAAACAGAAGTGATTGATGG + Intergenic