ID: 1148397018

View in Genome Browser
Species Human (GRCh38)
Location 17:47317073-47317095
Sequence AATACAATCCCCACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148397018 Original CRISPR AATACAATCCCCACTGGGTG TGG (reversed) Intronic
900604526 1:3517924-3517946 CATCAAACCCCCACTGGGTGGGG - Intronic
908087181 1:60648013-60648035 AATACAATCCCCAGTGTTGGAGG - Intergenic
911302391 1:96191554-96191576 AATATAATCCCCAATGGTGGAGG + Intergenic
911727096 1:101253155-101253177 AATAGATACCCCGCTGGGTGGGG - Intergenic
912724822 1:112049656-112049678 AATATAATCCCCAATGTCTGAGG - Intergenic
919402300 1:197134372-197134394 AATGCACTCCAGACTGGGTGAGG + Intronic
919491645 1:198212462-198212484 AAAAGAATCCCCATTGGGAGTGG - Intronic
920281732 1:204848514-204848536 AATAAAATTCGCACCGGGTGTGG - Intronic
921524146 1:216196193-216196215 AATACAATATCAACTGAGTGTGG + Intronic
922882494 1:228991197-228991219 TATACAACACCCAGTGGGTGTGG - Intergenic
922977935 1:229800765-229800787 AATGCAATCCCCACTGCTGGAGG + Intergenic
923239615 1:232069794-232069816 CAAACAATCCCCGCCGGGTGCGG - Intergenic
1064734210 10:18364100-18364122 AATACAAAATCAACTGGGTGTGG - Intronic
1066067177 10:31770997-31771019 AATGCAATCCCCAATGGTGGAGG + Intergenic
1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG + Exonic
1070295683 10:75159347-75159369 AATACATGTCCCGCTGGGTGTGG - Intronic
1071549457 10:86555362-86555384 AAAACAGCTCCCACTGGGTGCGG - Intergenic
1071717533 10:88112503-88112525 AATGCAATCCTGGCTGGGTGTGG + Intergenic
1072511578 10:96130776-96130798 AATCCAACTGCCACTGGGTGTGG - Intronic
1074279510 10:112037645-112037667 AACACAATCCCCACTACGGGGGG - Intergenic
1074322176 10:112413433-112413455 AATACAATCCCCGCCAGGTGTGG + Intronic
1074685687 10:115960596-115960618 AATACAATCCCAGTTGGGTTAGG + Intergenic
1076568798 10:131417654-131417676 GATACAATCCCTCCTGTGTGTGG - Intergenic
1077680150 11:4232276-4232298 AAATGAATCCCAACTGGGTGGGG + Intergenic
1077681338 11:4243629-4243651 AAATGAATCCCGACTGGGTGGGG - Intergenic
1077684434 11:4277732-4277754 AAATCAATCCTGACTGGGTGGGG + Intergenic
1077685606 11:4289036-4289058 AAATCAATCCTGACTGGGTGGGG - Intergenic
1077689559 11:4328853-4328875 AAATAAATCCCGACTGGGTGGGG + Intergenic
1078404111 11:11054407-11054429 AATTCAATCCCCTCTGGGGAAGG + Intergenic
1080228050 11:29983235-29983257 ATTATAATCCCCACATGGTGAGG - Intergenic
1081899253 11:46613959-46613981 AAAACAATCCTGTCTGGGTGCGG - Intronic
1082193363 11:49273465-49273487 ATTGTAATCCCCACTGGCTGGGG + Intergenic
1085681585 11:78580417-78580439 ACTACACTCCCACCTGGGTGTGG + Intergenic
1086672777 11:89567717-89567739 ATTATAATCCCCACTGGTTGGGG - Intergenic
1089691907 11:120192217-120192239 AAGACATTCCCCACCGGGTGAGG + Intergenic
1093073576 12:14733529-14733551 AATACAAAACTCGCTGGGTGTGG - Intergenic
1093166360 12:15808273-15808295 AATACATTTCGGACTGGGTGTGG - Intronic
1096915495 12:55027415-55027437 AATACAGTCTTCACTGAGTGAGG + Exonic
1098038829 12:66334169-66334191 ACCACAATCCCTGCTGGGTGTGG + Intronic
1105970629 13:25426449-25426471 AATACAATCCCCAGTGTTGGAGG - Intronic
1107946350 13:45420398-45420420 AATACAATCCCCAGCCTGTGGGG + Intergenic
1110604378 13:77414518-77414540 AATAACATCCACACTTGGTGAGG + Intergenic
1111295935 13:86277995-86278017 AAAACAATCCTGGCTGGGTGCGG + Intergenic
1114185983 14:20402866-20402888 AGTACAATACCAGCTGGGTGTGG + Intronic
1116632562 14:47354474-47354496 AATAAACTCCTCCCTGGGTGGGG - Intronic
1116671301 14:47846211-47846233 GATCCACTCCTCACTGGGTGGGG + Intergenic
1118942665 14:70352475-70352497 AAAAAGATCTCCACTGGGTGTGG - Intronic
1119016327 14:71059681-71059703 AAAAAAATCCCGGCTGGGTGTGG - Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119939023 14:78620557-78620579 AACACCATCCACTCTGGGTGAGG - Intronic
1120320193 14:82950060-82950082 AAAACAATCAGGACTGGGTGCGG + Intergenic
1121765441 14:96481634-96481656 AATGCATTTCTCACTGGGTGTGG - Intronic
1124610679 15:31206423-31206445 AATAAAATCACAACAGGGTGTGG + Intergenic
1124656334 15:31511938-31511960 AAAAAAATCCCCACTGAGTGGGG - Intronic
1126406057 15:48323867-48323889 AGTATTATCCCGACTGGGTGTGG - Intergenic
1128452681 15:67815136-67815158 AAGTGAATCACCACTGGGTGGGG - Intergenic
1130221623 15:82024391-82024413 AAAAAAATCCCGGCTGGGTGTGG - Intergenic
1131016615 15:89062676-89062698 AAATCAATTCCAACTGGGTGCGG - Intergenic
1135050775 16:19191283-19191305 AATACCATCCCCTCGGGGTTAGG - Intronic
1135402227 16:22174040-22174062 ATTATAATCCTCACTGGGTGCGG + Intronic
1137728825 16:50675028-50675050 CATTTAATCCTCACTGGGTGAGG - Intronic
1139782847 16:69366014-69366036 ACTACAATCCTCACTCTGTGAGG - Intronic
1139854273 16:69968206-69968228 ATTACAATCCCCACGGGTTGAGG + Intergenic
1139883253 16:70191120-70191142 ATTACAATCCCCACGGGTTGAGG + Intergenic
1140369254 16:74404401-74404423 ATTACAATCCCCACGGGTTGAGG - Intergenic
1142576101 17:908811-908833 AATACACTCCCGGCTGGGTGCGG + Intronic
1142798847 17:2331381-2331403 AATACAATCCCCAGTGTTGGAGG + Intronic
1148047202 17:44751403-44751425 AAGGCAATGCCCACTGGGTCTGG - Exonic
1148397018 17:47317073-47317095 AATACAATCCCCACTGGGTGTGG - Intronic
1150543065 17:66123388-66123410 AATTCCATTCCCAGTGGGTGTGG - Intronic
1150550546 17:66205521-66205543 AATACAAAATTCACTGGGTGTGG + Intergenic
1152829362 17:82487666-82487688 AAGACTATCCCGGCTGGGTGCGG + Intronic
1158103570 18:53859104-53859126 AATACAGCCCCCCCTGGGTATGG - Intergenic
1158705105 18:59785399-59785421 AATACAAAATCAACTGGGTGTGG + Intergenic
1159333367 18:67030703-67030725 AATACAATCCCCAATGCTGGAGG + Intergenic
1159726276 18:71963687-71963709 ATTATAATCCCCACTTGTTGGGG - Intergenic
1160830128 19:1100350-1100372 AATACAAAACTAACTGGGTGTGG + Intergenic
1161354591 19:3811743-3811765 AATAAAATCCCCACCGGGCACGG - Intronic
1162268678 19:9596486-9596508 ATTACATTCCCCTCTGGGGGTGG - Intergenic
1166721274 19:44997783-44997805 AATACAAAACTAACTGGGTGTGG - Intergenic
927284440 2:21341880-21341902 AAAACAGTCCCCAGTGTGTGAGG - Intergenic
928621909 2:33098586-33098608 AATACAAAATTCACTGGGTGTGG - Intronic
929511183 2:42567783-42567805 AATACAATCTCCTCTGTTTGGGG + Intronic
929585472 2:43111316-43111338 AATGAAAACCCTACTGGGTGTGG - Intergenic
932482016 2:72048368-72048390 AATACAATTAGCTCTGGGTGTGG + Intergenic
934759934 2:96849105-96849127 AATAAAATTCCCAATGGGTAGGG - Intronic
935033283 2:99343244-99343266 AATACAACCCAGGCTGGGTGCGG - Intronic
935707046 2:105866068-105866090 AATACAAAATCAACTGGGTGTGG - Intronic
938222566 2:129582727-129582749 AATATAATCCCCACTGTTGGAGG - Intergenic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
940896459 2:159085811-159085833 AATGTAATCCGCACTAGGTGGGG - Intronic
941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG + Intronic
941164290 2:162068871-162068893 AATATAATTCCCACATGGTGGGG + Intronic
941319352 2:164034963-164034985 AATACAAAACCAGCTGGGTGTGG - Intergenic
941380813 2:164790094-164790116 AAATCAATTCACACTGGGTGGGG + Intronic
941923078 2:170870976-170870998 TGTACAATCCTAACTGGGTGGGG - Intergenic
942099700 2:172567882-172567904 AATAGGAGCCCCACTGGGGGTGG - Intronic
943913853 2:193603021-193603043 AACCCAATTCCGACTGGGTGCGG - Intergenic
947959161 2:234220422-234220444 CATACCATCCCCTCTGGGTGAGG - Intergenic
948340815 2:237250032-237250054 AAGATAATCTCGACTGGGTGTGG + Intergenic
1169852090 20:10063616-10063638 ACTCCACTCCCCACTGTGTGGGG + Intergenic
1170033315 20:11965184-11965206 AATCCAATCATCTCTGGGTGGGG + Intergenic
1173947530 20:46963573-46963595 AAAACAATCCCCAGTGAGTATGG - Intronic
1173993806 20:47322697-47322719 AATACCATCCTGGCTGGGTGTGG - Intronic
1174494816 20:50931629-50931651 TATATAATCCCCACTGAGGGGGG + Intergenic
1174845456 20:53938873-53938895 AAGGCAATCCACAATGGGTGTGG + Intronic
1174873169 20:54202042-54202064 AATACAAAATTCACTGGGTGTGG + Intergenic
1178947020 21:36957132-36957154 AATGTAATCCCCAGTGGTTGAGG + Intronic
1179836675 21:44039174-44039196 GAAAGAATCACCACTGGGTGAGG - Intronic
1181729579 22:24834916-24834938 AATACAATCCCCGCTGGCAGAGG - Intronic
1181965788 22:26655976-26655998 AATACAATTCAGGCTGGGTGTGG - Intergenic
949387296 3:3517395-3517417 AATGCAATCCCCACTGTTGGAGG + Intergenic
950787666 3:15449762-15449784 ATTACCCTCCCCACAGGGTGAGG - Intronic
953330510 3:42049161-42049183 AATAACATCCCTGCTGGGTGCGG - Intronic
953941466 3:47102498-47102520 GTTACAATCCCAGCTGGGTGCGG + Intronic
955428093 3:58813478-58813500 AACACCAACCCCACTGGGTTTGG - Intronic
957768026 3:84650773-84650795 AAAAAAATCTCCACTGGGTATGG - Intergenic
960669783 3:120144974-120144996 AAGAAAATCCCAGCTGGGTGCGG + Intergenic
960731117 3:120728129-120728151 AATAGAATGGGCACTGGGTGGGG + Intronic
961725712 3:128927960-128927982 AATAAAATCCCCGCCAGGTGCGG + Intronic
964331703 3:155610067-155610089 AAGACCATCACCACTGGGTGCGG + Intronic
970093042 4:12431066-12431088 ATTACATTCCCCTCTGGGGGTGG - Intergenic
972784443 4:42313995-42314017 ATTACATTCCCCTCTGGGGGCGG + Intergenic
974409477 4:61520995-61521017 AATTTAATCCCCATTGGGTTAGG + Intronic
976172725 4:82320955-82320977 AAGACAATCTCGGCTGGGTGTGG + Intergenic
977328392 4:95606031-95606053 AAGACAATGCCCTCGGGGTGGGG + Intergenic
977393054 4:96437574-96437596 ATTATAATCTCCACTGGTTGTGG - Intergenic
979049216 4:115909233-115909255 AATATAATCCCCACTGTTCGAGG - Intergenic
980497173 4:133601079-133601101 AATTCAACCCCCAATGGGTTTGG - Intergenic
980614074 4:135195193-135195215 AATATAATCCCCAGGAGGTGGGG + Intergenic
981353945 4:143765375-143765397 AACTCAATCCCCAGTGGTTGAGG - Intergenic
985186661 4:187324800-187324822 AATACAATCCTCAGCAGGTGCGG + Intergenic
985772263 5:1820042-1820064 TATAGAATGCCCACTGGTTGCGG + Intergenic
985877142 5:2608786-2608808 AATACAATTACGGCTGGGTGCGG + Intergenic
992108872 5:73473700-73473722 AATACCAACCCCACTGAGTTGGG - Intergenic
992902817 5:81315959-81315981 AATATAATCTCCACGGGGGGTGG + Intergenic
995175972 5:109177392-109177414 AAAACTATTCCCACTGGGTCTGG - Intronic
995187484 5:109287405-109287427 AATACAATCCCGGCCAGGTGTGG + Intergenic
997866723 5:137470441-137470463 AATACTATCACCACAGTGTGGGG - Intronic
998074642 5:139225611-139225633 AATACATTTGGCACTGGGTGTGG + Intronic
998827160 5:146114441-146114463 AATAAAAGCCACGCTGGGTGCGG + Intronic
1004514599 6:16311775-16311797 AAAACAATCTCCACTTGATGTGG - Intronic
1004857147 6:19762799-19762821 AATACAATATCTGCTGGGTGCGG - Intergenic
1006326180 6:33355725-33355747 ATTACATTCCCCTCTGGGGGTGG - Intergenic
1006808376 6:36803854-36803876 AATACAAATCTCAGTGGGTGGGG + Intronic
1007767242 6:44167956-44167978 AGTACAATTCCAGCTGGGTGTGG + Intronic
1012053467 6:94373733-94373755 AATGCAATCCCCACTGTTGGAGG - Intergenic
1013482713 6:110565983-110566005 AAAAATATCCCCGCTGGGTGTGG + Intergenic
1014716556 6:124871870-124871892 AATACAAACCAGGCTGGGTGCGG + Intergenic
1014720182 6:124907606-124907628 AATACAAAAACTACTGGGTGTGG - Intergenic
1016525277 6:144994677-144994699 AATACAAAATTCACTGGGTGTGG + Intergenic
1019079438 6:169420210-169420232 AACACAATCTCAGCTGGGTGCGG - Intergenic
1020828696 7:13065791-13065813 AAAACAATCCTGGCTGGGTGCGG + Intergenic
1021301581 7:18979912-18979934 AATATAATCCCCAGTGTGGGAGG - Intronic
1023436770 7:40147782-40147804 ATTACATTCCCCTCTGGGGGTGG - Intronic
1025722205 7:64027122-64027144 TTTACAATCCCCACTGGGGCAGG + Intergenic
1025750937 7:64293436-64293458 TTTACAATCCCCACTGGGCACGG + Intergenic
1029149202 7:98468118-98468140 ATTATAATCCCCACGTGGTGAGG + Intergenic
1029901285 7:104042875-104042897 AATATAAGCTCCACAGGGTGAGG - Intergenic
1031665238 7:124475379-124475401 AAATCAATCCTGACTGGGTGGGG + Intergenic
1033222958 7:139540711-139540733 AATCCAAGGCCCACTGGTTGAGG + Intronic
1033997895 7:147374931-147374953 ATTATAATCCCCACAGGTTGAGG + Intronic
1034746556 7:153528591-153528613 AATATAATCCCCAATGTGGGAGG - Intergenic
1035405733 7:158595915-158595937 ATTACAATCCCCACTGTTGGAGG - Intergenic
1036421116 8:8596486-8596508 AATACCTTCCCGACTGGGCGCGG + Intergenic
1043226748 8:77742846-77742868 AAAACAATACCGACTGGGTGTGG + Intergenic
1046876586 8:119261302-119261324 AATACAATACCCACTTGGAAGGG + Intergenic
1048386495 8:133917366-133917388 AGAACAATCCCCACTGCTTGTGG + Intergenic
1048773306 8:137918932-137918954 ATTATAGTTCCCACTGGGTGTGG + Intergenic
1053617522 9:39783262-39783284 AATACAATCCCGGCTGGGCGCGG + Intergenic
1053896948 9:42752008-42752030 AATACAATCCCGGCTGGGTGCGG - Intergenic
1054266645 9:62924175-62924197 AATACAATCCCGGCTGGGCACGG - Intergenic
1054550140 9:66593629-66593651 AATACAATCCCGGCTGGGCGCGG - Intergenic
1054896049 9:70312413-70312435 AGTACAATCCCCACTTGCTGAGG - Intronic
1057806281 9:98222017-98222039 AAAAACATCTCCACTGGGTGTGG - Intronic
1058935514 9:109766244-109766266 AATACTATTCCCACTGGGCAGGG - Intronic
1059652971 9:116332924-116332946 GATACAGTCCCCACTTGGGGTGG - Intronic
1060118431 9:120965231-120965253 AATGCAGTCCCAGCTGGGTGCGG + Intronic
1061435417 9:130558184-130558206 AATACAATACTAGCTGGGTGTGG + Intergenic
1186037517 X:5440916-5440938 AATGCAATCCCCACTTGTTGAGG - Intergenic
1187355862 X:18570929-18570951 TATAGAAACCCCACTGAGTGAGG - Intronic
1187794743 X:22991019-22991041 AACACAATACCAGCTGGGTGCGG - Intergenic
1189886011 X:45545719-45545741 ATTGTAATCCCCAATGGGTGGGG - Intergenic
1193016689 X:76741521-76741543 AATACAAACTCCACTGGGATGGG + Intergenic
1194529416 X:95026496-95026518 AATACAATCCCCAGTGTTGGAGG + Intergenic
1194625395 X:96220925-96220947 ATTATAATCCCCACTTGTTGAGG - Intergenic
1195702076 X:107713155-107713177 AAAACAGCCCCTACTGGGTGAGG + Intergenic
1199278210 X:145970889-145970911 ATTACATTCCCCTCTGGGGGCGG + Intergenic
1200422261 Y:2984395-2984417 AATACAAAAACAACTGGGTGTGG + Intergenic
1201098862 Y:10656128-10656150 ACTACAATCCAGCCTGGGTGAGG - Intergenic