ID: 1148397221

View in Genome Browser
Species Human (GRCh38)
Location 17:47318792-47318814
Sequence GCAGTTCTACACTCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148397220_1148397221 -5 Left 1148397220 17:47318774-47318796 CCATTTGAGTACAGGTTTGCAGT 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1148397221 17:47318792-47318814 GCAGTTCTACACTCAAAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148397221 Original CRISPR GCAGTTCTACACTCAAAGCC TGG Intronic
902446917 1:16472977-16472999 GCAGTTCTACCCTAAAAGAAGGG - Intergenic
902838758 1:19062377-19062399 GCAGCACGAGACTCAAAGCCAGG - Intergenic
905246349 1:36617010-36617032 GCACTTGTACACACACAGCCAGG - Intergenic
905596943 1:39215638-39215660 AAAGTTCTACACCCAAAGCTTGG - Intronic
914462711 1:147899460-147899482 GAAGAGCCACACTCAAAGCCAGG + Intergenic
916916107 1:169408267-169408289 GCAGTTTTCCCCTCACAGCCAGG + Intronic
918473950 1:184903777-184903799 GCAGCACTGCACTCCAAGCCTGG - Intronic
922976376 1:229787185-229787207 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1066246558 10:33589189-33589211 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1067326603 10:45274547-45274569 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1069563314 10:69446763-69446785 GCAGTTGTATCCTCAGAGCCTGG + Intergenic
1073483243 10:103800078-103800100 TCACTTCTACCCTCACAGCCAGG - Intronic
1073645808 10:105302441-105302463 GCACTTTTTCACTCAAAGCATGG + Intergenic
1074456150 10:113597039-113597061 GCAGTGCTACACTGCATGCCCGG + Intronic
1075006612 10:118835215-118835237 GCAGTTCCAGATCCAAAGCCAGG + Intergenic
1075530018 10:123221244-123221266 GAAGTTCTCCAATCAATGCCAGG - Intergenic
1078563869 11:12396837-12396859 ACACTACTACAGTCAAAGCCTGG - Intronic
1078663570 11:13306331-13306353 GCAGTTCTACTGTCACGGCCAGG - Intronic
1079192558 11:18292616-18292638 GTAGTTTTACACACAAAGCTAGG + Intronic
1080174163 11:29342182-29342204 GCAGTTCTAGACTAATAGGCTGG + Intergenic
1087699739 11:101422709-101422731 GAATTTCTAAACTTAAAGCCAGG - Intergenic
1089338944 11:117744756-117744778 CCAGGTCTAGAATCAAAGCCAGG - Intronic
1090944339 11:131416209-131416231 CCTTTTCTACACCCAAAGCCAGG + Intronic
1101005646 12:100398634-100398656 GAATTTATACACTCCAAGCCTGG - Intronic
1101494442 12:105240168-105240190 GCACTACTATACTAAAAGCCAGG + Intronic
1102264829 12:111474560-111474582 GCACTACTGCACTCCAAGCCTGG + Intronic
1102395629 12:112583574-112583596 GCAGCTCTGCATTAAAAGCCAGG + Intronic
1103133609 12:118489035-118489057 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1104801070 12:131555645-131555667 GCAGGGCTGCACTCAAAGACTGG + Intergenic
1105325614 13:19368202-19368224 GCAGGGCAACACTCAAACCCTGG - Intergenic
1105867890 13:24476972-24476994 GCAGGGCGACACTCAAACCCTGG + Intronic
1106784506 13:33093303-33093325 TCAGGTCTCCTCTCAAAGCCTGG + Intergenic
1108003392 13:45924710-45924732 GCAGTTCAGCACAAAAAGCCTGG + Intergenic
1109595617 13:64549758-64549780 GCAGCTCAACAGTCAAAGGCCGG - Intergenic
1112588577 13:100742699-100742721 CCAGTGCTAGATTCAAAGCCTGG - Intergenic
1117080083 14:52142812-52142834 AGAGTTCTACATTCAAAGCCTGG - Intergenic
1119068373 14:71553805-71553827 TCAGTTCTACACTAAAAACTAGG - Intronic
1119110530 14:71969557-71969579 GAAGTTCTCCACACAAAGCTGGG - Intronic
1120641112 14:87014078-87014100 ACAGGTCTACCCTCAAAGCAGGG + Intergenic
1120872386 14:89349169-89349191 GCAATTCTCCACTCCAATCCTGG + Intronic
1121344119 14:93122542-93122564 GCAATACTGCACTCCAAGCCTGG + Intergenic
1133324145 16:4933245-4933267 CCAGCTCTCCCCTCAAAGCCTGG + Intronic
1135424761 16:22326914-22326936 GCAATACCACACTCAAGGCCTGG - Intronic
1137749030 16:50845011-50845033 GCAGTTCTTTAATCTAAGCCAGG - Intergenic
1137768011 16:50992690-50992712 CCTGTTCCACACTCAGAGCCAGG - Intergenic
1142169055 16:88610886-88610908 GCAATTCTGCAGTCACAGCCCGG - Intronic
1144119859 17:12141567-12141589 TCATTTCTAGACTCAAAACCTGG + Exonic
1148397221 17:47318792-47318814 GCAGTTCTACACTCAAAGCCTGG + Intronic
1153810331 18:8746891-8746913 GCAGTTCTATTCTCAAAGAAAGG + Intronic
1154153437 18:11925696-11925718 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1156641497 18:39106327-39106349 CCAATTCTACACTCAATGGCAGG - Intergenic
1157583765 18:48788265-48788287 GAAGCTCTATACTCAAAGCTGGG - Intronic
1160911344 19:1475187-1475209 GCAGCTCTACCAGCAAAGCCGGG - Exonic
1161821905 19:6534835-6534857 GCAGGTCCACGGTCAAAGCCAGG - Exonic
1162172491 19:8802223-8802245 GCAGCTCAACAGTCAAAGACAGG - Intergenic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1163154746 19:15433526-15433548 GCAGTTATTCACTGAAAGACTGG + Intronic
1164218484 19:23172435-23172457 GCAGCTCAACAGTCAAAGACAGG - Intergenic
1164562410 19:29301468-29301490 GAAGTTCTCCACATAAAGCCAGG + Intergenic
1164625197 19:29723258-29723280 GCAGTTCCAGACTCTGAGCCTGG - Intergenic
1166098232 19:40554850-40554872 CCACTACTACACTCAAATCCAGG - Intronic
1166887237 19:45969462-45969484 GCACCACTACACTCCAAGCCTGG + Intronic
927359650 2:22217912-22217934 GCTGTTGTAGACTCACAGCCAGG + Intergenic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
928543168 2:32302934-32302956 TCAGTTCTAAATTCAAACCCTGG + Intronic
929738646 2:44578436-44578458 GCAGATCTACACTCAAATAAGGG - Intronic
934712678 2:96526258-96526280 ACAGTGCTGCACACAAAGCCTGG - Intergenic
936490007 2:112961802-112961824 CCATGTCTACACTCAAAGACGGG - Intergenic
937376557 2:121340231-121340253 CCAATTCTACGCTGAAAGCCAGG + Exonic
938225949 2:129616461-129616483 GCAGCTCAACAGTCAAAGACAGG - Intergenic
942666753 2:178327841-178327863 CCATTTCTACACAGAAAGCCAGG + Intronic
944335314 2:198526838-198526860 GCAATTCTAAACTCAAAGTAAGG - Intronic
946045226 2:216815361-216815383 CCAGTTCTATACTCAAGGCTTGG + Intergenic
947200802 2:227613016-227613038 GCAGTTCTACAGGTGAAGCCTGG + Intronic
948419521 2:237847984-237848006 GCAGGTCAACACTCAAATTCAGG - Intergenic
1169716729 20:8627842-8627864 GCAGGTCTACGCTGAGAGCCAGG + Intronic
1170319580 20:15080198-15080220 GGAGTTCTGCTCTAAAAGCCTGG - Intronic
949617863 3:5774744-5774766 GCAGCTCAACAGTCAAAGACAGG - Intergenic
949653926 3:6194296-6194318 GCAGCTCAACAGTCAAAGACAGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
958269203 3:91477663-91477685 GCAGCTCAACAGTCAAAGACAGG - Intergenic
959532255 3:107447119-107447141 TCAGTCCTTCACCCAAAGCCTGG + Intergenic
962428934 3:135301656-135301678 GCACTGCTCCACTCAGAGCCTGG - Intergenic
964357137 3:155861176-155861198 GCACCACTACACTCACAGCCTGG + Intergenic
975374971 4:73632599-73632621 GCAGTTCTACCCCAAAAGTCAGG + Intergenic
980179309 4:129384820-129384842 GCAGAACTACCCTCAGAGCCTGG - Intergenic
984684957 4:182657102-182657124 ACAGTTCTATACTCAAATCCTGG + Intronic
986444672 5:7811003-7811025 GCAATACTACAATCAAAGCATGG - Intronic
987348170 5:16997247-16997269 GCAGTTCCACACCCAGAGGCAGG - Intergenic
989039239 5:37209513-37209535 GCAGTTCTCCACTCAATACAGGG - Intronic
990709744 5:58566962-58566984 GCAGTCTAACACTCAAAGCCAGG - Intergenic
996633879 5:125667335-125667357 GCAGCTCAACAGTCAAAGACAGG + Intergenic
997330572 5:133058335-133058357 TGAGTACTACACTCCAAGCCTGG + Intronic
1001653961 5:173335042-173335064 GCCTATCTACACTCAAAACCAGG + Intergenic
1001822321 5:174720187-174720209 GTAGTTCTATATTCAAATCCAGG - Intergenic
1002628966 5:180555935-180555957 GCAGTACTACAGTTAAAGGCAGG + Intronic
1002687551 5:181025601-181025623 GAATTTCTAAACTCAAAGACAGG + Intergenic
1005608853 6:27503857-27503879 GCAGCTCTGCTCTCAGAGCCAGG - Intergenic
1005948601 6:30614374-30614396 GCAGTTGTAAACTCAAGGCAGGG - Intronic
1006113728 6:31764073-31764095 ACAGATTTACACTCAGAGCCTGG + Exonic
1006364989 6:33610048-33610070 GCAGTGCTGCACTCAGAGACAGG + Intergenic
1008986023 6:57544077-57544099 GCAGCTCAACAGTCAAAGACAGG + Intronic
1009173982 6:60436628-60436650 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1011879496 6:92007046-92007068 GCAGTTCTCCAGTCAGAGCAGGG - Intergenic
1013769771 6:113614663-113614685 GCAGTTCAAAACTCAAACTCAGG - Intergenic
1017856206 6:158351250-158351272 GCAGTTCTGCACTAAAAGAATGG - Intronic
1017988775 6:159468360-159468382 GCACTTCTTCTCTCAATGCCTGG - Intergenic
1021448056 7:20754724-20754746 GTAGTTCTAAACTCAAAGTCAGG - Intronic
1022005940 7:26265692-26265714 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1022238198 7:28482864-28482886 GCTGTTCTAATCTGAAAGCCTGG - Intronic
1022579758 7:31539634-31539656 ACAGTTCAACAGTCAAAGACAGG + Intronic
1022964103 7:35456862-35456884 GCAGTCCTACCCTGACAGCCTGG + Intergenic
1024876916 7:54036645-54036667 GCAGCTCAACAGTCAAAGACAGG - Intergenic
1025052952 7:55744012-55744034 GCTGTTCTACAGCCAAAGCTGGG + Intergenic
1025234805 7:57227408-57227430 GCAGTTCTCCCCACTAAGCCTGG - Intergenic
1030869788 7:114741127-114741149 GCAGTTCTTCACAAAGAGCCCGG + Intergenic
1031773698 7:125879456-125879478 GCAGCTCAACAGTCAAAGACAGG - Intergenic
1034051639 7:147990294-147990316 GCAGCTCAACAGTCAAAGACAGG + Intronic
1037235719 8:16717324-16717346 GCAGCTCAACAGTCAAAGACAGG - Intergenic
1037252418 8:16912102-16912124 TCAGTTGTATACTCAGAGCCTGG + Intergenic
1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG + Intergenic
1040029579 8:42812576-42812598 GCATTTCTTCATTCCAAGCCTGG - Intergenic
1040434820 8:47380149-47380171 TCAGACCTACACTCAAAACCTGG - Intronic
1041882106 8:62763766-62763788 GCAGCTCAACAGTCAAAGACAGG + Intronic
1046234018 8:111397899-111397921 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1048185693 8:132238503-132238525 GCGGATCTACAGTCAAAGACAGG - Intronic
1052041030 9:23739325-23739347 GCAGTTCTACCTTCAAACACTGG + Intronic
1052240083 9:26261406-26261428 GCAGCTCAACAGTCAAAGACAGG + Intergenic
1052606889 9:30715421-30715443 CCTGGTCTACACTCAAAACCAGG - Intergenic
1055689189 9:78811158-78811180 GCAGTACTACACTTAGAGCATGG - Intergenic
1056687444 9:88778213-88778235 GCAGCTCTACCCTCAGAGCATGG + Intergenic
1060961522 9:127684022-127684044 GAAGATTTACACCCAAAGCCTGG - Intronic
1185610244 X:1390052-1390074 GCACCACTACACTCAAACCCGGG - Intronic
1186867682 X:13736516-13736538 GCAGTTCTCCACTCAATACAGGG - Exonic
1193563860 X:83053703-83053725 ACAGTTGTACACCCAACGCCTGG + Intergenic
1199440356 X:147860894-147860916 TCAGTTCAACTCTGAAAGCCTGG - Intergenic
1199936952 X:152583499-152583521 GCAGGTCAACACTCAAATTCAGG + Intergenic
1200740617 Y:6849985-6850007 GCAGGTTCACACTCAAAGCTGGG + Intergenic