ID: 1148403438

View in Genome Browser
Species Human (GRCh38)
Location 17:47388031-47388053
Sequence GTTCAGCAGTACCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 12, 2: 29, 3: 42, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148403438_1148403441 5 Left 1148403438 17:47388031-47388053 CCTACAGTGTGGTACTGCTGAAC 0: 1
1: 12
2: 29
3: 42
4: 149
Right 1148403441 17:47388059-47388081 CTCTGATTTGGTGTCTCCTTTGG 0: 11
1: 26
2: 68
3: 88
4: 243
1148403438_1148403439 -7 Left 1148403438 17:47388031-47388053 CCTACAGTGTGGTACTGCTGAAC 0: 1
1: 12
2: 29
3: 42
4: 149
Right 1148403439 17:47388047-47388069 GCTGAACAGCCACTCTGATTTGG 0: 21
1: 71
2: 56
3: 63
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148403438 Original CRISPR GTTCAGCAGTACCACACTGT AGG (reversed) Intronic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
906538046 1:46562828-46562850 ATTCTGCAGAGCCACACTGTGGG + Exonic
907908247 1:58804654-58804676 GTGCAGCAGTAACACACAGGAGG + Intergenic
908881896 1:68742225-68742247 TTTCAGCAATACCCCACTTTTGG - Intergenic
910616473 1:89204354-89204376 GTATAGCAGTACCCCACTCTTGG - Intergenic
912640665 1:111342537-111342559 GTTCAGCAGTGCAAAGCTGTAGG - Intergenic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1065405127 10:25355866-25355888 GTTCTGCATTTCCACACTATTGG - Intronic
1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG + Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073750936 10:106526503-106526525 GTTCCCCAGTGCCACAGTGTTGG + Intergenic
1075354381 10:121757424-121757446 TTTCAGCAGTACCCCACTCCTGG + Intronic
1076647141 10:131961261-131961283 GTTCAGCAGTCCCCGACAGTGGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080717698 11:34819771-34819793 TTTCAGCAGTACCCTACTCTTGG + Intergenic
1081742090 11:45448014-45448036 GTTCAGCAGAAAGACACTGGAGG + Intergenic
1082195310 11:49297973-49297995 GCTATGCAGTACCTCACTGTGGG - Intergenic
1082614967 11:55348593-55348615 TTTCAGCAGTGCCCCACTCTCGG - Intergenic
1086660621 11:89411579-89411601 GCTACGCAGTACCTCACTGTGGG + Intronic
1087208109 11:95418168-95418190 CTTCATCAGTCCCACATTGTGGG + Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1088915059 11:114221303-114221325 GATCAGCAGTCACACACGGTTGG - Intronic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094254799 12:28411074-28411096 GTTATGCATTACCACACAGTAGG - Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095206942 12:39449121-39449143 GTTCAGAAGGGCCACACTCTTGG - Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096602461 12:52739266-52739288 GTTAAACAATATCACACTGTGGG + Intergenic
1097453867 12:59771329-59771351 GTACAGCTGTACCTCACTATGGG + Exonic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1105902391 13:24767024-24767046 ATTCAACATTAACACACTGTGGG + Intronic
1106192532 13:27466306-27466328 CTTCAGCAGGACCACAGTGGAGG + Intergenic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108560959 13:51643536-51643558 GTTCATCAATACCACCCTGTAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1112895856 13:104298939-104298961 GGTCAGAACTACCATACTGTAGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1117888877 14:60396340-60396362 GTCCAGAAGTAGCAAACTGTAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1132532217 16:458078-458100 GCTCAGGAATTCCACACTGTGGG + Intronic
1133436768 16:5786531-5786553 GTTCTGCACTACCCCAGTGTGGG + Intergenic
1138986291 16:62332664-62332686 GTTCAGCTGTAGAAAACTGTAGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139551538 16:67675752-67675774 GGTCAGCAGGTCCACAATGTAGG + Exonic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1148396851 17:47315225-47315247 GTACTTCAGTCCCACACTGTTGG - Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1151323936 17:73367551-73367573 GTGCAGCAGTAGCACAATCTCGG + Intronic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1154009416 18:10562315-10562337 GTTCCTCAGTAAAACACTGTGGG + Intergenic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155037928 18:22041048-22041070 GATCAGGAGTACCACATTTTAGG + Intergenic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156318248 18:35992113-35992135 GTTAAGCAGTGCCACACTACAGG - Exonic
1156697926 18:39790044-39790066 GTTCAGCAGTCCCCAACTGGTGG - Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1158482550 18:57834896-57834918 GATCACCAGGACCACACAGTAGG - Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1160494755 18:79366336-79366358 GAACCGCAGAACCACACTGTGGG + Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
1168376066 19:55880631-55880653 GTGCAACTGTCCCACACTGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927888812 2:26735539-26735561 GATCATCAGAACAACACTGTGGG + Intergenic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
929703342 2:44184329-44184351 TGTCAGGGGTACCACACTGTTGG + Intronic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
933460214 2:82573659-82573681 ATTCAGCTGTACCATGCTGTAGG - Intergenic
938653951 2:133411765-133411787 TTTCTGCATTTCCACACTGTTGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941805753 2:169710822-169710844 GTTCAGAAGGACCCCACTCTTGG - Intronic
941862198 2:170294818-170294840 GTTCAGTTGTACCACTCTGGTGG + Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1169307329 20:4503465-4503487 GATCAGTAGTGCCACACAGTGGG - Intergenic
1170349918 20:15427652-15427674 GCTCATCAGTACAACACTGAAGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
1184150628 22:42636332-42636354 GTCCAGTAGTACCAGGCTGTGGG + Intronic
949665161 3:6330836-6330858 TTTCAGCAGTACCCCACTGCTGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
962444695 3:135454212-135454234 TTTCAGCAGTCCCTGACTGTTGG + Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
964537124 3:157735175-157735197 GTTCAGCAGCTTCACACAGTAGG + Intergenic
964641016 3:158910697-158910719 GCACAGCAGTGCCACACTGCTGG - Intergenic
965083940 3:164070012-164070034 GTTCAGCACTTATACACTGTTGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
966765207 3:183455283-183455305 CTTCTGCAGTACCACAGTGGAGG + Intergenic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
976476353 4:85488110-85488132 GTTCAGCTGTGAGACACTGTGGG + Intronic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
977022318 4:91773400-91773422 TTTCAGCAATACCCCACTGCTGG + Intergenic
977147823 4:93467713-93467735 ATTAAGCAGTGCCACACTGCAGG - Intronic
977217555 4:94299596-94299618 GATTTGCAGTACCACACTTTTGG - Exonic
978969068 4:114780532-114780554 GTTCAATAGCACCACACTATAGG - Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984379620 4:178974852-178974874 ATTCAGCAGAAGCACCCTGTTGG + Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
991237452 5:64416263-64416285 GTTCAGTGATACCACACTATAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
993920063 5:93790681-93790703 GCTCAGCAGTGCCACGCTGGGGG + Intronic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997164583 5:131646191-131646213 ATTCTGTAGTACCACACTGTTGG - Intronic
998794222 5:145800521-145800543 GTTGAGCAGTCTCACACTCTTGG + Intronic
999329805 5:150665238-150665260 GCTCAGCAGTACCCCACCCTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999502907 5:152164682-152164704 GATCAGCAGTCCCAAACTTTTGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001426485 5:171625919-171625941 GGTCCTCAGGACCACACTGTTGG - Intergenic
1001430838 5:171660712-171660734 GTTCAGCATTGGCACACTGGCGG + Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003590867 6:7435581-7435603 ATTTAGCAGTACGACACTGTAGG + Intergenic
1004009253 6:11666208-11666230 ATTCAGCAGTACCAAGATGTTGG + Intergenic
1005824888 6:29626890-29626912 GTTGAGCATTCCCAGACTGTGGG - Intronic
1007040805 6:38720357-38720379 GTTTGGCAGTACCATGCTGTGGG + Intronic
1011895151 6:92216248-92216270 GTACAGCAGTGCCCCACTCTCGG - Intergenic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1013264182 6:108478495-108478517 GATCAACATTACCACCCTGTCGG - Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1020466161 7:8482101-8482123 GTTCAGCAGTTTCACTCTGTTGG - Intronic
1021527187 7:21601513-21601535 GTTCATCAGTAGCTCTCTGTCGG - Exonic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1021866496 7:24963376-24963398 TGTCAGCAGTGCCACTCTGTGGG + Intronic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1027603046 7:80263343-80263365 GTTCAACAAGACGACACTGTGGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1031559058 7:123215532-123215554 TTTCAGCAGTACCCCACTCCTGG - Intergenic
1031587375 7:123548591-123548613 CTTAAGCAGTACCAAACTGCTGG - Intronic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1036541818 8:9721610-9721632 GTTAAGAACTACCAGACTGTAGG - Intronic
1040616881 8:49046292-49046314 GGTCACCAGAACCACACTGGAGG + Intergenic
1041965029 8:63666647-63666669 GTTCAGCAGTACCCCACTTCTGG - Intergenic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1044837116 8:96306546-96306568 GTGCAGAATTACCTCACTGTGGG - Exonic
1046941092 8:119932316-119932338 GATCTGCATAACCACACTGTGGG + Intronic
1047476657 8:125238851-125238873 GTTCTGCAGTAAGACACTGTGGG + Intronic
1048133538 8:131723295-131723317 GTTCAGCTAAACTACACTGTTGG + Intergenic
1050095417 9:2060039-2060061 GCTCAGCAGTACCAGACTTCAGG + Intronic
1050268752 9:3919074-3919096 GGTCAGCAGTACCATCCAGTTGG - Intronic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052525518 9:29614179-29614201 GTACACCATTTCCACACTGTTGG - Intergenic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060653774 9:125353502-125353524 TTTTAGCAGTACCCCACTCTCGG + Intronic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187982528 X:24773424-24773446 GTTCTTCTGTACCATACTGTGGG + Intronic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1191934055 X:66407348-66407370 TTTCAGCAATACCCCACTCTTGG + Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192718678 X:73669437-73669459 GCTCAGCAGTTCCACCATGTGGG - Intronic
1193515775 X:82461170-82461192 CTTCAGCAGTAATAAACTGTAGG - Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1198303861 X:135360384-135360406 GATCAGCAGAACCCCACTCTGGG + Exonic
1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG + Intergenic
1199133283 X:144220052-144220074 GCCCAGCAATGCCACACTGTGGG - Intergenic