ID: 1148406779

View in Genome Browser
Species Human (GRCh38)
Location 17:47423294-47423316
Sequence ATGGTGAAGGGGCATTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148406779 Original CRISPR ATGGTGAAGGGGCATTTTGT TGG Intronic
900846791 1:5110375-5110397 ATGGAGCAGGGACCTTTTGTTGG + Intergenic
901297342 1:8170572-8170594 ATGGTCAAGGGGCATCCGGTTGG + Intergenic
902199381 1:14822436-14822458 ATGGTGAAGGAGGATTTCTTGGG + Intronic
903533836 1:24053337-24053359 GTGGAGAAGGGGCACTATGTTGG + Intergenic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
906213207 1:44023789-44023811 AGGGTGGAGGGACATTTTCTGGG + Intronic
906255216 1:44343825-44343847 AGGGTGATGGGGCATTAGGTCGG + Intronic
906424790 1:45702130-45702152 ATTGTCAAGGGGCATTTTGTGGG - Intronic
908345780 1:63231091-63231113 GTGGTGTAGGGACATTATGTTGG - Intergenic
909852807 1:80489695-80489717 ATGGAGAAGTGCAATTTTGTTGG + Intergenic
909865806 1:80669130-80669152 TTGGTGATTGGTCATTTTGTTGG + Intergenic
911984441 1:104602620-104602642 ATGGGGTAGGGCCATTTTATAGG - Intergenic
916257502 1:162804668-162804690 GTGGAGAAAGAGCATTTTGTGGG + Intronic
918093127 1:181314425-181314447 AGGGTGAAGGGGAATTATCTGGG + Intergenic
919029629 1:192224801-192224823 ATGATGAATGGGGATATTGTGGG - Intergenic
919039138 1:192360006-192360028 ATGGTGAAAGGGCAATCAGTAGG - Intronic
919353319 1:196488519-196488541 AGGGTAAAAGGGCATTTGGTGGG - Intronic
920834647 1:209498612-209498634 ATGGTGAATGATCATTTTATGGG + Intergenic
922751275 1:228071173-228071195 ATGGTGTAGGGGGATAATGTAGG + Intergenic
922751526 1:228072341-228072363 ATAGTGAAGGGGAATAGTGTGGG + Intergenic
1063473286 10:6306382-6306404 ATGGTTAAGTGGTATTTTGGGGG + Intergenic
1063544569 10:6967983-6968005 AGAATGATGGGGCATTTTGTTGG - Intergenic
1063654503 10:7974321-7974343 AGGGGGAAGGGGCGGTTTGTGGG + Intronic
1064478266 10:15715167-15715189 ACCATGAAGGGGCATTCTGTGGG + Intronic
1064700858 10:18020040-18020062 ATGGGTAAGGTGCATATTGTGGG + Intronic
1066723951 10:38370354-38370376 GTGGAGAAAGAGCATTTTGTGGG + Intergenic
1067086994 10:43247740-43247762 TTGGGGAAGGGGCAGTTTGAGGG + Intronic
1070492052 10:76986546-76986568 AGGGTGAAGGGGAATCTGGTGGG + Intronic
1071419869 10:85482258-85482280 ATTGTGAATGAGCATTTTCTTGG - Intergenic
1071528686 10:86373172-86373194 CTGGGGAAGGGGCTTTCTGTTGG - Intergenic
1074841308 10:117354483-117354505 ATGGGGTAGGAGCATATTGTGGG - Intronic
1079306707 11:19329786-19329808 ATGATGAAGTGACATTTTGGTGG + Intergenic
1079362311 11:19779205-19779227 ATGGGGAAAGGGTATTTTGGTGG - Intronic
1081189727 11:40088638-40088660 ATGGCCAAGGGGCATTGTGGTGG + Intergenic
1081535612 11:43993849-43993871 GCGGTGAACGGGCATTTAGTGGG + Intergenic
1081857375 11:46312403-46312425 TTGGTGAGGGGGAGTTTTGTGGG - Exonic
1085646617 11:78227882-78227904 TTGGTTAAGAGGCATTTTGAGGG + Intronic
1086954210 11:92919126-92919148 ATGGTGATGGGGAATTTTAAAGG + Intergenic
1087019384 11:93587300-93587322 TTGATGAAGGGGCATTTTCATGG + Intergenic
1090732789 11:129586170-129586192 ATGGTGACGGTGGATTTTTTTGG + Intergenic
1090768899 11:129901883-129901905 AAGGAGAAGGGGCATTTTGTGGG - Exonic
1091496363 12:976507-976529 ATGCTGAAGAGGCCATTTGTAGG + Intronic
1093555677 12:20470826-20470848 TTGGTGAAGGGGCCTTTGGCAGG + Intronic
1093772686 12:23035891-23035913 TTGGTGAAGGGGCCTTTTGGAGG - Intergenic
1093833441 12:23795652-23795674 ATGCTGAATGGGAGTTTTGTGGG + Intronic
1100879879 12:99004699-99004721 ATGGTGAATGGTCAATGTGTTGG + Intronic
1103021437 12:117537942-117537964 ATGGGGAAGGGCCGTTTTATGGG - Intronic
1103168546 12:118792351-118792373 ATCGTGTAGGGTCATTTTTTTGG + Intergenic
1104444928 12:128824890-128824912 ATGGTGTAGGGGCAGTCTCTGGG - Intergenic
1109305747 13:60638878-60638900 ATGTTGAAATGGCATTTAGTGGG + Intergenic
1112571192 13:100595086-100595108 ATGGAGAAGGGGCAGGCTGTAGG - Intergenic
1112809822 13:103204992-103205014 ATGGAAAAGGGGCATCATGTTGG - Intergenic
1113199654 13:107852668-107852690 ATGGTGAAGGACCATTTTCTCGG - Intronic
1114152855 14:20064275-20064297 ATCCTGAAGGGGCCTTTTCTTGG + Intergenic
1114768408 14:25401009-25401031 ATGGAGAAAGGGCATTATTTAGG - Intergenic
1116559690 14:46362207-46362229 AGGGTGAAGGGGCATTTGAGTGG - Intergenic
1117012312 14:51483416-51483438 ATGGTGATGGGGCATTTGAAGGG + Intergenic
1118098485 14:62567445-62567467 ATGGTGAAGGCACATTCTGCAGG + Intergenic
1118369448 14:65125018-65125040 ATGTTGTAGTGGCATTTTGGGGG + Intergenic
1118911081 14:70062750-70062772 ATTGTCAAGAGGCATTTTTTTGG + Intronic
1120255865 14:82118900-82118922 ATAGTGAAAGGGGAATTTGTTGG + Intergenic
1120974414 14:90236099-90236121 ATGGGTAAGGGGCTTTTTGGAGG - Intergenic
1122647444 14:103204634-103204656 AGGGTGAAGGGGCAGGTTGTGGG - Intergenic
1123943384 15:25227373-25227395 CTGGTGACGGGGCATGTTGGAGG + Intergenic
1124122793 15:26905236-26905258 ATTTTGAAGGATCATTTTGTTGG + Intronic
1124930851 15:34118043-34118065 ATTGGGAAGGGGCATTTTCCTGG - Intergenic
1126493659 15:49266725-49266747 ATGGTGATAAAGCATTTTGTTGG + Intronic
1126557495 15:50005201-50005223 TTGGGGAAGGGGCGTTGTGTTGG - Intronic
1131644333 15:94325716-94325738 CTCATGAAGGGGCATTTTCTAGG - Intronic
1132015539 15:98313201-98313223 GTGGGGAAGGGCCATTTTGGGGG - Intergenic
1133943560 16:10329952-10329974 ATGGTGAAGGGGGGTTTTTAAGG - Intronic
1134231822 16:12435786-12435808 ATGGTGAGGATGCACTTTGTTGG + Intronic
1134855889 16:17518730-17518752 ATGAAGAATGGGCATTTTCTTGG + Intergenic
1137439270 16:48484035-48484057 ATGATGAAGTGGCATATTTTGGG + Intergenic
1137901927 16:52277976-52277998 AAGGTGGAGGGGGAATTTGTTGG + Intergenic
1140708905 16:77657887-77657909 TTTGTGAAGAGGTATTTTGTAGG - Intergenic
1144334572 17:14257236-14257258 ATGCTGAAGGGGCAATTGGATGG - Intergenic
1146759806 17:35467280-35467302 ATGGAGATGGGGCCATTTGTTGG - Intronic
1147254570 17:39174325-39174347 AGGGTGAAGGAGCAGTTTTTTGG + Exonic
1148406779 17:47423294-47423316 ATGGTGAAGGGGCATTTTGTTGG + Intronic
1148407387 17:47428904-47428926 ATGGTGAGGGGACATTTTGTTGG + Intronic
1148679568 17:49465965-49465987 AGGGAGAAGGGGGATTCTGTGGG - Intronic
1154143876 18:11850021-11850043 ATGGTGAAGGTGGCTTTTGAAGG + Intronic
1155156631 18:23163156-23163178 ATGGAGATGGGGCAGTTTGAAGG + Intronic
1158050496 18:53212173-53212195 ATGGAGATGAGGTATTTTGTAGG - Intronic
1159655384 18:71026147-71026169 AAGCTGCAGGGGCATTATGTTGG + Intergenic
1162203479 19:9038226-9038248 ATGCTAAAGGGGCATATTTTGGG - Intergenic
1165267621 19:34674695-34674717 ATGGTGAAGAGGCAATATATGGG + Intronic
1165551313 19:36588780-36588802 ATGGGGAAGGGGCATATTGTTGG - Intronic
1167759426 19:51435814-51435836 TTGGAGATGGGGCTTTTTGTAGG - Intergenic
1168498594 19:56874849-56874871 GTGGGGATGGGGCATTTTGCAGG - Intergenic
925581181 2:5413236-5413258 ATGATGAAGTGCCATATTGTGGG - Intergenic
925945559 2:8859740-8859762 ATGGGGAAGTGGAATTTGGTGGG + Intronic
926003552 2:9353758-9353780 ATGGTAAAGGAACATCTTGTAGG - Intronic
926954041 2:18273859-18273881 AAGGAGAAGGGGCCTTTAGTGGG - Intronic
928277609 2:29917243-29917265 ATGCTGATGGGGCTATTTGTGGG - Intronic
930956535 2:57209550-57209572 ATTGTAAAGGGTCATGTTGTGGG - Intergenic
931857419 2:66317822-66317844 ATGCTGAAGGGGCATTTGGCAGG + Intergenic
932755355 2:74404411-74404433 AAGGGGAAGGGGGATTTTATAGG + Intergenic
933262649 2:80147554-80147576 ATTTACAAGGGGCATTTTGTTGG - Intronic
933860910 2:86466681-86466703 ATGGGGAAGGTGCATGTTCTAGG - Exonic
934029810 2:88033068-88033090 ATTCTAAAGGGGCATTTTTTGGG + Intronic
937871984 2:126792562-126792584 AGGAGGAAGGGGCATTTTATAGG - Intergenic
940094905 2:149963127-149963149 ATGGTGATGGGACATTTTTGCGG + Intergenic
940353475 2:152715342-152715364 ATTGTAAATGGACATTTTGTAGG - Intronic
943917402 2:193653826-193653848 ATGGAGAAGAGGGATTTTTTAGG - Intergenic
943962051 2:194277328-194277350 ATGGAGAAGTCACATTTTGTGGG + Intergenic
944918701 2:204388229-204388251 ATGGTGAGGGGGCAGTGTGCTGG - Intergenic
945693410 2:213070963-213070985 CTAGTGAAGGTGCATTTAGTTGG + Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947311699 2:228809900-228809922 ATAGTGAAGGGGAAGTTTGGGGG - Intergenic
1168815457 20:733739-733761 CTGGTGAGGGGGCACTTGGTGGG + Intergenic
1168838092 20:891169-891191 CTGGTGAAGGGGCATGTGATTGG - Intronic
1174208636 20:48859387-48859409 ATCTTCATGGGGCATTTTGTGGG - Intergenic
1177665933 21:24159371-24159393 ATGGTAAAGTGGCATGTTTTGGG + Intergenic
1178152106 21:29807254-29807276 ACAGGGAAGGGGCAGTTTGTTGG - Intronic
1178905750 21:36634621-36634643 ATGGTGGGGGGGCGTTTTGGGGG - Intergenic
1184267981 22:43360159-43360181 AGGGTTAAGTGGGATTTTGTGGG + Intergenic
951164713 3:19471079-19471101 ATGGGGAAGGGGAGTTTAGTTGG + Intronic
951422914 3:22509317-22509339 AGGATGAAGGGGGATTTTCTAGG - Intergenic
951699409 3:25479932-25479954 AAGGGTAATGGGCATTTTGTGGG - Intronic
952285763 3:31968132-31968154 AGGGTAAAGGGGCATTATGTTGG - Intronic
953261048 3:41339333-41339355 ATTGGCAAGGGGCATTGTGTGGG - Intronic
960531510 3:118770980-118771002 ATGATGAAGGGGCATTTATTAGG + Intergenic
964094187 3:152912486-152912508 TTGGTGAGGAGGCATTGTGTGGG - Intergenic
966618164 3:181934490-181934512 ATGGTGAAGGGGGATTGTAAAGG + Intergenic
969203980 4:5628366-5628388 ATGGTGGAAGGGCATCATGTGGG - Intronic
972683108 4:41325865-41325887 ATGTGGAGGGGGCATTTTGTGGG + Intergenic
973190625 4:47381298-47381320 CTGGTGACTGGGCATTTTGTGGG + Intronic
975153592 4:71046063-71046085 ATGGTGAATGAGGTTTTTGTGGG - Intergenic
976518001 4:85993941-85993963 ATGGTGAAGAGGATTTTTGGAGG + Intronic
977686960 4:99858006-99858028 AGGGTGATGGGGCATCATGTAGG - Intronic
978157454 4:105506095-105506117 ATTGAGAAGGAGCATGTTGTGGG - Intergenic
983459021 4:168003996-168004018 AAGGTGAAGTGGCACTGTGTGGG + Intergenic
988722046 5:33889073-33889095 CTCGTGAAGGGGCATTTATTAGG + Intronic
992395059 5:76362421-76362443 ATGGTAAGGGGTGATTTTGTGGG - Intergenic
992698274 5:79313056-79313078 ATGCTGAAGGATCACTTTGTAGG + Intronic
993231116 5:85237765-85237787 ATGGTGAAGGGGTGTTCTGTGGG + Intergenic
995727994 5:115202715-115202737 ATGATGAAGGAGCAGTTTGGGGG + Intergenic
997722313 5:136089006-136089028 ATGGTGGGGGGTCATTTTGGGGG - Intergenic
998607169 5:143647284-143647306 ACGGTCAAGGGCCATTTTGAAGG - Intergenic
1000527402 5:162374914-162374936 ATGATGAAAGGGAATTATGTAGG - Intergenic
1006145503 6:31956849-31956871 AAGGGGAAGAGGCATTATGTTGG + Intronic
1006370617 6:33641610-33641632 AGGGTGAAGGGGCCTTATGGTGG - Intronic
1009810894 6:68664836-68664858 AGGGTGAAGGGGGCTTTTGGAGG + Intronic
1014296127 6:119620153-119620175 CTTGTGAAGGGGCATCGTGTTGG + Intergenic
1016390042 6:143565645-143565667 ATGGAGCAGGGGCATTAGGTGGG + Intronic
1016596296 6:145805305-145805327 AAGGTGAAGGTGAATTGTGTTGG - Exonic
1017148657 6:151258064-151258086 ATGGTTAAGGGAGAGTTTGTAGG - Intronic
1018198630 6:161376223-161376245 ATGGATAAGGGGCAGTTCGTTGG + Intronic
1018737603 6:166699356-166699378 AAGGTAAAAGGGCATTTTTTTGG + Intronic
1019079463 6:169420424-169420446 ATGGTGAAGTGGCAAATGGTAGG - Intergenic
1031422775 7:121569381-121569403 ATGGGGTGGGGCCATTTTGTAGG + Intergenic
1031685199 7:124724968-124724990 ATCGTAAATGGGCCTTTTGTTGG - Intergenic
1034150934 7:148914832-148914854 AAGGTGAAGGTGGAATTTGTTGG + Intergenic
1034473473 7:151269162-151269184 ATGGTGAAGGGGGAGTTAGAAGG + Intronic
1034491186 7:151393910-151393932 ATGCTGAAGGGGCGTGTTTTGGG - Intronic
1037262502 8:17024496-17024518 GTGGAGTAGGGGCATTTTGGGGG + Intergenic
1038589449 8:28823171-28823193 ATGCTGAAGTGGCATATTGTAGG - Intronic
1038791844 8:30675085-30675107 ATGGTGAAGAGGCAACGTGTAGG + Intergenic
1046076204 8:109315228-109315250 ATGTTGAAGTGGCATTATTTCGG - Intronic
1047954423 8:129962536-129962558 ATAGGGAAGGGACATTTTCTGGG - Intronic
1049071171 8:140357235-140357257 ATGGTGAAGGGGCAGGGTGTGGG + Intronic
1049165448 8:141122705-141122727 AAGGGGAAGAGGCATTTTCTGGG - Intronic
1049714443 8:144083224-144083246 ATGGTGGAGGAGCAGTTTGCGGG + Exonic
1050096620 9:2073898-2073920 ATGGTGAAGTGGTCTTTTGGGGG + Intronic
1051159477 9:14190832-14190854 ATGAAGATGGGGCATTTTATGGG + Intronic
1052092802 9:24350072-24350094 ATGGAAAAGGGCCATTTTATGGG - Intergenic
1053156226 9:35781438-35781460 GAGGGGAAGGGGCATTTTCTTGG + Intergenic
1058095444 9:100855001-100855023 ATGGTGAGGGGGCATTTTGTTGG + Intergenic
1060059550 9:120446819-120446841 ATGGTGAAGTGGCATTTGAAGGG - Intronic
1186941321 X:14510635-14510657 ATGGTGAAGGGACATATTCCTGG + Intergenic
1193645349 X:84061524-84061546 CTGGTGATGGGGATTTTTGTGGG - Intronic
1193912228 X:87319382-87319404 ATGCTCAAGGAGCATTTTGGAGG - Intergenic
1196046439 X:111260749-111260771 TTGGAGAAGGGGCCTCTTGTGGG - Intronic
1198163688 X:134032501-134032523 CTTGTGAAAGGGCATTTTGCAGG - Intergenic
1198282192 X:135153403-135153425 ATGGAGGAGGGGCATTTGGGAGG - Intergenic
1198288767 X:135219119-135219141 ATGGAGGAGGGGCATTTGGGAGG + Intergenic
1200006752 X:153090358-153090380 ATGTTGCATGGGCTTTTTGTTGG + Intergenic
1201581060 Y:15512578-15512600 AAGGTGTAGGGCCATTTTATAGG - Intergenic