ID: 1148410821

View in Genome Browser
Species Human (GRCh38)
Location 17:47465527-47465549
Sequence TAGGCCCCTCAGCTCCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148410817_1148410821 -7 Left 1148410817 17:47465511-47465533 CCCAAAAAGGCTTTCCTAGGCCC No data
Right 1148410821 17:47465527-47465549 TAGGCCCCTCAGCTCCTAGGAGG No data
1148410814_1148410821 -3 Left 1148410814 17:47465507-47465529 CCGCCCCAAAAAGGCTTTCCTAG No data
Right 1148410821 17:47465527-47465549 TAGGCCCCTCAGCTCCTAGGAGG No data
1148410818_1148410821 -8 Left 1148410818 17:47465512-47465534 CCAAAAAGGCTTTCCTAGGCCCC No data
Right 1148410821 17:47465527-47465549 TAGGCCCCTCAGCTCCTAGGAGG No data
1148410816_1148410821 -6 Left 1148410816 17:47465510-47465532 CCCCAAAAAGGCTTTCCTAGGCC No data
Right 1148410821 17:47465527-47465549 TAGGCCCCTCAGCTCCTAGGAGG No data
1148410812_1148410821 14 Left 1148410812 17:47465490-47465512 CCATTTTCTCAGGACTACCGCCC No data
Right 1148410821 17:47465527-47465549 TAGGCCCCTCAGCTCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148410821 Original CRISPR TAGGCCCCTCAGCTCCTAGG AGG Intergenic