ID: 1148415186

View in Genome Browser
Species Human (GRCh38)
Location 17:47500838-47500860
Sequence TCCAGGAATTGGGTTTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148415186_1148415190 7 Left 1148415186 17:47500838-47500860 CCTGTGTAAACCCAATTCCTGGA No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data
1148415186_1148415191 8 Left 1148415186 17:47500838-47500860 CCTGTGTAAACCCAATTCCTGGA No data
Right 1148415191 17:47500869-47500891 TACCTATGTTGAGAGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148415186 Original CRISPR TCCAGGAATTGGGTTTACAC AGG (reversed) Intergenic
No off target data available for this crispr