ID: 1148415188

View in Genome Browser
Species Human (GRCh38)
Location 17:47500849-47500871
Sequence GTATTTAAACATCCAGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148415188_1148415195 26 Left 1148415188 17:47500849-47500871 CCAATTCCTGGATGTTTAAATAC No data
Right 1148415195 17:47500898-47500920 ATTAATTCCTCACTACCAGTGGG No data
1148415188_1148415196 29 Left 1148415188 17:47500849-47500871 CCAATTCCTGGATGTTTAAATAC No data
Right 1148415196 17:47500901-47500923 AATTCCTCACTACCAGTGGGAGG No data
1148415188_1148415190 -4 Left 1148415188 17:47500849-47500871 CCAATTCCTGGATGTTTAAATAC No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data
1148415188_1148415191 -3 Left 1148415188 17:47500849-47500871 CCAATTCCTGGATGTTTAAATAC No data
Right 1148415191 17:47500869-47500891 TACCTATGTTGAGAGATTCAGGG No data
1148415188_1148415194 25 Left 1148415188 17:47500849-47500871 CCAATTCCTGGATGTTTAAATAC No data
Right 1148415194 17:47500897-47500919 CATTAATTCCTCACTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148415188 Original CRISPR GTATTTAAACATCCAGGAAT TGG (reversed) Intergenic