ID: 1148415189

View in Genome Browser
Species Human (GRCh38)
Location 17:47500855-47500877
Sequence ACATAGGTATTTAAACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148415189_1148415195 20 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415195 17:47500898-47500920 ATTAATTCCTCACTACCAGTGGG No data
1148415189_1148415199 27 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415199 17:47500905-47500927 CCTCACTACCAGTGGGAGGTGGG No data
1148415189_1148415194 19 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415194 17:47500897-47500919 CATTAATTCCTCACTACCAGTGG No data
1148415189_1148415190 -10 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data
1148415189_1148415196 23 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415196 17:47500901-47500923 AATTCCTCACTACCAGTGGGAGG No data
1148415189_1148415197 26 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415197 17:47500904-47500926 TCCTCACTACCAGTGGGAGGTGG No data
1148415189_1148415191 -9 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415191 17:47500869-47500891 TACCTATGTTGAGAGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148415189 Original CRISPR ACATAGGTATTTAAACATCC AGG (reversed) Intergenic