ID: 1148415190

View in Genome Browser
Species Human (GRCh38)
Location 17:47500868-47500890
Sequence ATACCTATGTTGAGAGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148415189_1148415190 -10 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data
1148415186_1148415190 7 Left 1148415186 17:47500838-47500860 CCTGTGTAAACCCAATTCCTGGA No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data
1148415188_1148415190 -4 Left 1148415188 17:47500849-47500871 CCAATTCCTGGATGTTTAAATAC No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data
1148415187_1148415190 -3 Left 1148415187 17:47500848-47500870 CCCAATTCCTGGATGTTTAAATA No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data
1148415183_1148415190 30 Left 1148415183 17:47500815-47500837 CCGGATCTCAGACTGCAGGGAGG No data
Right 1148415190 17:47500868-47500890 ATACCTATGTTGAGAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148415190 Original CRISPR ATACCTATGTTGAGAGATTC AGG Intergenic