ID: 1148415192

View in Genome Browser
Species Human (GRCh38)
Location 17:47500871-47500893
Sequence ATCCCTGAATCTCTCAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148415192_1148415197 10 Left 1148415192 17:47500871-47500893 CCTATGTTGAGAGATTCAGGGAT No data
Right 1148415197 17:47500904-47500926 TCCTCACTACCAGTGGGAGGTGG No data
1148415192_1148415199 11 Left 1148415192 17:47500871-47500893 CCTATGTTGAGAGATTCAGGGAT No data
Right 1148415199 17:47500905-47500927 CCTCACTACCAGTGGGAGGTGGG No data
1148415192_1148415195 4 Left 1148415192 17:47500871-47500893 CCTATGTTGAGAGATTCAGGGAT No data
Right 1148415195 17:47500898-47500920 ATTAATTCCTCACTACCAGTGGG No data
1148415192_1148415194 3 Left 1148415192 17:47500871-47500893 CCTATGTTGAGAGATTCAGGGAT No data
Right 1148415194 17:47500897-47500919 CATTAATTCCTCACTACCAGTGG No data
1148415192_1148415196 7 Left 1148415192 17:47500871-47500893 CCTATGTTGAGAGATTCAGGGAT No data
Right 1148415196 17:47500901-47500923 AATTCCTCACTACCAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148415192 Original CRISPR ATCCCTGAATCTCTCAACAT AGG (reversed) Intergenic