ID: 1148415194

View in Genome Browser
Species Human (GRCh38)
Location 17:47500897-47500919
Sequence CATTAATTCCTCACTACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148415192_1148415194 3 Left 1148415192 17:47500871-47500893 CCTATGTTGAGAGATTCAGGGAT No data
Right 1148415194 17:47500897-47500919 CATTAATTCCTCACTACCAGTGG No data
1148415188_1148415194 25 Left 1148415188 17:47500849-47500871 CCAATTCCTGGATGTTTAAATAC No data
Right 1148415194 17:47500897-47500919 CATTAATTCCTCACTACCAGTGG No data
1148415187_1148415194 26 Left 1148415187 17:47500848-47500870 CCCAATTCCTGGATGTTTAAATA No data
Right 1148415194 17:47500897-47500919 CATTAATTCCTCACTACCAGTGG No data
1148415189_1148415194 19 Left 1148415189 17:47500855-47500877 CCTGGATGTTTAAATACCTATGT No data
Right 1148415194 17:47500897-47500919 CATTAATTCCTCACTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148415194 Original CRISPR CATTAATTCCTCACTACCAG TGG Intergenic