ID: 1148416654

View in Genome Browser
Species Human (GRCh38)
Location 17:47511752-47511774
Sequence GTCACAGGCTAAGGCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148416654_1148416661 -5 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416661 17:47511770-47511792 GTGACAGAGGAAGGAGAATGGGG No data
1148416654_1148416668 17 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416668 17:47511792-47511814 GTGGGATCACAGGCGGAGGAGGG No data
1148416654_1148416667 16 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416667 17:47511791-47511813 GGTGGGATCACAGGCGGAGGAGG No data
1148416654_1148416662 -2 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416662 17:47511773-47511795 ACAGAGGAAGGAGAATGGGGTGG No data
1148416654_1148416663 -1 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG No data
1148416654_1148416665 10 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416665 17:47511785-47511807 GAATGGGGTGGGATCACAGGCGG No data
1148416654_1148416659 -7 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG No data
1148416654_1148416660 -6 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416660 17:47511769-47511791 TGTGACAGAGGAAGGAGAATGGG No data
1148416654_1148416666 13 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416666 17:47511788-47511810 TGGGGTGGGATCACAGGCGGAGG No data
1148416654_1148416664 7 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416664 17:47511782-47511804 GGAGAATGGGGTGGGATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148416654 Original CRISPR GTCACAGGCTAAGGCAGTCC TGG (reversed) Intergenic
No off target data available for this crispr