ID: 1148416656

View in Genome Browser
Species Human (GRCh38)
Location 17:47511761-47511783
Sequence CCTTCCTCTGTCACAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148416656_1148416664 -2 Left 1148416656 17:47511761-47511783 CCTTAGCCTGTGACAGAGGAAGG No data
Right 1148416664 17:47511782-47511804 GGAGAATGGGGTGGGATCACAGG No data
1148416656_1148416665 1 Left 1148416656 17:47511761-47511783 CCTTAGCCTGTGACAGAGGAAGG No data
Right 1148416665 17:47511785-47511807 GAATGGGGTGGGATCACAGGCGG No data
1148416656_1148416663 -10 Left 1148416656 17:47511761-47511783 CCTTAGCCTGTGACAGAGGAAGG No data
Right 1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG No data
1148416656_1148416666 4 Left 1148416656 17:47511761-47511783 CCTTAGCCTGTGACAGAGGAAGG No data
Right 1148416666 17:47511788-47511810 TGGGGTGGGATCACAGGCGGAGG No data
1148416656_1148416668 8 Left 1148416656 17:47511761-47511783 CCTTAGCCTGTGACAGAGGAAGG No data
Right 1148416668 17:47511792-47511814 GTGGGATCACAGGCGGAGGAGGG No data
1148416656_1148416667 7 Left 1148416656 17:47511761-47511783 CCTTAGCCTGTGACAGAGGAAGG No data
Right 1148416667 17:47511791-47511813 GGTGGGATCACAGGCGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148416656 Original CRISPR CCTTCCTCTGTCACAGGCTA AGG (reversed) Intergenic
No off target data available for this crispr