ID: 1148416664

View in Genome Browser
Species Human (GRCh38)
Location 17:47511782-47511804
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148416654_1148416664 7 Left 1148416654 17:47511752-47511774 CCAGGACTGCCTTAGCCTGTGAC No data
Right 1148416664 17:47511782-47511804 GGAGAATGGGGTGGGATCACAGG No data
1148416656_1148416664 -2 Left 1148416656 17:47511761-47511783 CCTTAGCCTGTGACAGAGGAAGG No data
Right 1148416664 17:47511782-47511804 GGAGAATGGGGTGGGATCACAGG No data
1148416658_1148416664 -8 Left 1148416658 17:47511767-47511789 CCTGTGACAGAGGAAGGAGAATG No data
Right 1148416664 17:47511782-47511804 GGAGAATGGGGTGGGATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148416664 Original CRISPR GGAGAATGGGGTGGGATCAC AGG Intergenic
No off target data available for this crispr