ID: 1148416665 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:47511785-47511807 |
Sequence | GAATGGGGTGGGATCACAGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148416654_1148416665 | 10 | Left | 1148416654 | 17:47511752-47511774 | CCAGGACTGCCTTAGCCTGTGAC | No data | ||
Right | 1148416665 | 17:47511785-47511807 | GAATGGGGTGGGATCACAGGCGG | No data | ||||
1148416656_1148416665 | 1 | Left | 1148416656 | 17:47511761-47511783 | CCTTAGCCTGTGACAGAGGAAGG | No data | ||
Right | 1148416665 | 17:47511785-47511807 | GAATGGGGTGGGATCACAGGCGG | No data | ||||
1148416658_1148416665 | -5 | Left | 1148416658 | 17:47511767-47511789 | CCTGTGACAGAGGAAGGAGAATG | No data | ||
Right | 1148416665 | 17:47511785-47511807 | GAATGGGGTGGGATCACAGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148416665 | Original CRISPR | GAATGGGGTGGGATCACAGG CGG | Intergenic | ||
No off target data available for this crispr |