ID: 1148425952

View in Genome Browser
Species Human (GRCh38)
Location 17:47596182-47596204
Sequence ACTTAGTTGCAGAAGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148425947_1148425952 15 Left 1148425947 17:47596144-47596166 CCGTATCTCAAAAAATACCAGTT 0: 1
1: 0
2: 4
3: 56
4: 854
Right 1148425952 17:47596182-47596204 ACTTAGTTGCAGAAGAGGGGTGG 0: 1
1: 0
2: 1
3: 11
4: 178
1148425948_1148425952 -2 Left 1148425948 17:47596161-47596183 CCAGTTTTTATGATAGAATTTAC 0: 1
1: 0
2: 3
3: 23
4: 292
Right 1148425952 17:47596182-47596204 ACTTAGTTGCAGAAGAGGGGTGG 0: 1
1: 0
2: 1
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148425952 Original CRISPR ACTTAGTTGCAGAAGAGGGG TGG Intronic
901414634 1:9108222-9108244 GGTTAGTTGCAGAAGATTGGGGG - Intronic
904929309 1:34073758-34073780 ACATAGTGGCTAAAGAGGGGTGG - Intronic
905223713 1:36466290-36466312 AGCTAGCTGGAGAAGAGGGGAGG - Exonic
905409085 1:37755964-37755986 CCTGTGTGGCAGAAGAGGGGAGG + Intronic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
906912415 1:49968599-49968621 ACTTAGCTGCAGTAGAGGCTGGG - Intronic
907094526 1:51765284-51765306 ACTTAGGTGGAAAAGAGGAGAGG + Intronic
907585857 1:55617247-55617269 ACTTATTTTCAGAAAAAGGGGGG + Intergenic
913306566 1:117433930-117433952 CCTTAGTTGCAGAGGAGGCTTGG + Intronic
913963057 1:143354015-143354037 ACGAAGGGGCAGAAGAGGGGAGG + Intergenic
914057412 1:144179600-144179622 ACGAAGGGGCAGAAGAGGGGAGG + Intergenic
914121734 1:144786766-144786788 ACGAAGGGGCAGAAGAGGGGAGG - Intergenic
915978986 1:160408566-160408588 GCTGAGTGGCAGAGGAGGGGTGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
916591320 1:166193610-166193632 ATTTAGTTGCAGAGCAGGGTGGG + Intergenic
916896069 1:169163204-169163226 ACTGAAGTGGAGAAGAGGGGAGG + Intronic
917560677 1:176151584-176151606 ATTTAGTTGCAGAGAAGGGTAGG - Intronic
918135897 1:181673749-181673771 ACTGTGTTTCAGGAGAGGGGTGG - Intronic
918661032 1:187089323-187089345 ACTTACTTGCAGAACAGGAGAGG + Intergenic
918987639 1:191653770-191653792 ACGTAGTTGGAGAAGAGGAAGGG + Intergenic
920116969 1:203628315-203628337 ACCCAGTTGGAGAAGAGCGGCGG - Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921961422 1:221039006-221039028 ACTTAGTGGAAGAAGGGAGGAGG - Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1065427031 10:25616475-25616497 AATTCGTGCCAGAAGAGGGGTGG - Intergenic
1067382961 10:45792219-45792241 AAACAGTTGCTGAAGAGGGGTGG - Intronic
1067529710 10:47061305-47061327 AGTTAGCTGCAGAAGCCGGGAGG - Intergenic
1068732745 10:60377166-60377188 AGGTCCTTGCAGAAGAGGGGAGG + Intronic
1070079235 10:73168929-73168951 GCTTAATTGCAGAGGTGGGGAGG - Intronic
1070704859 10:78630338-78630360 ACTTTGAGGCAGAAGAGAGGAGG + Intergenic
1073253522 10:102136380-102136402 ACTTTGTTGCAGAAGAGGAAAGG + Intronic
1074222298 10:111449876-111449898 ACTTAGTGGGTGAAGAGAGGAGG - Intergenic
1076598004 10:131637896-131637918 ACTGAGCTGCAGAGGAGGGGAGG - Intergenic
1079348632 11:19674293-19674315 ACTTATTTACACAAGAGGGACGG + Intronic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1087048262 11:93862565-93862587 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1090736688 11:129617212-129617234 ACTTCGTTGAAGAAGTGGAGAGG - Intergenic
1092874949 12:12839843-12839865 ACATAGATGCTGAAGAGGTGAGG - Intergenic
1093863363 12:24195673-24195695 ACTTAGCTCCATAAGAGCGGGGG - Intergenic
1094752903 12:33434400-33434422 ATTTAGTTGCAGAAGAGATTTGG + Intronic
1096100137 12:48965863-48965885 TCTAAGGAGCAGAAGAGGGGTGG + Exonic
1097284669 12:57868302-57868324 ACTTAGCTGCAGGAGAGGTTGGG - Intergenic
1099862226 12:88234727-88234749 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
1103867143 12:124062316-124062338 ACTTGGGGGCAGAAGAGGGAAGG - Intronic
1106187936 13:27425188-27425210 ACTTATTTGCAGATTACGGGAGG - Intronic
1106395175 13:29372871-29372893 ATTTAGTGGGAGAAGAAGGGTGG - Intronic
1106872335 13:34035482-34035504 ACTGAGCTCCAGAAGTGGGGTGG + Intergenic
1108830129 13:54467332-54467354 ACATAGTTGGAGAAGAAGGCAGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1110920796 13:81082262-81082284 ACTTATTTGGTGAAGAGGTGTGG + Intergenic
1113504775 13:110807830-110807852 CTTTAGTAGCAGAAGAGGAGGGG - Intergenic
1116137062 14:40939659-40939681 TCTTAGATCCAGATGAGGGGAGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116764321 14:49051794-49051816 ATTTTGTGGCAGAAGAGGGCTGG - Intergenic
1120253331 14:82087738-82087760 ACTAATTTGAAGAAGAAGGGGGG + Intergenic
1120690533 14:87587977-87587999 ACATGGATGCAGAAGAGAGGAGG + Intergenic
1125797787 15:42416311-42416333 TCTTAGTTGCTGCAGGGGGGTGG + Exonic
1128546847 15:68574127-68574149 ACTGAGTTGCACAAGAGAGCAGG + Intergenic
1128787211 15:70406675-70406697 AGTTAGTTGCAGGAGAGGGGTGG - Intergenic
1129072740 15:72964537-72964559 ACTCAGTTGGAGAACAGGGAAGG - Intergenic
1129199915 15:73992484-73992506 GCTGAGTAGGAGAAGAGGGGAGG - Intronic
1130408912 15:83627822-83627844 ACTCAGATGAAAAAGAGGGGTGG - Intergenic
1137070791 16:35903118-35903140 ACTTATTAGCAGAAGAGAGTGGG - Intergenic
1139330910 16:66189186-66189208 ACATTGTGGAAGAAGAGGGGGGG + Intergenic
1140683007 16:77403889-77403911 ATCTAGTTGGAGAAGAGGGTTGG + Intronic
1141319294 16:82991807-82991829 ACATAGTTGAGGAAGAGGGAAGG + Intronic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1141922817 16:87147272-87147294 AGGTAGTTGCAGATGAGGGGTGG + Intronic
1142109500 16:88323683-88323705 ACTGAGTGGCAGAAGTGGGCAGG + Intergenic
1147715348 17:42503488-42503510 AATTAGTATCAGAAGAGGGAAGG - Intronic
1148425952 17:47596182-47596204 ACTTAGTTGCAGAAGAGGGGTGG + Intronic
1148858795 17:50593417-50593439 GCTGAGTGGCAGAGGAGGGGAGG - Intronic
1152066692 17:78115986-78116008 AGTGAGTTGCAGAAGGGGGTCGG - Intronic
1153371973 18:4328101-4328123 ACTTAGTAGGGGAAGCGGGGAGG - Intronic
1154206453 18:12341231-12341253 ACTTAATTGCAAAAGAGGACTGG - Intronic
1156879158 18:42055220-42055242 ACATAGTAGCATGAGAGGGGAGG - Intronic
1158123324 18:54074674-54074696 ACTTACATGGAGAAGAGGTGAGG - Intergenic
1158506081 18:58046321-58046343 AATTAGTGGCAGTAGAGGGCAGG + Intronic
1158596814 18:58823945-58823967 AGATAGTTTCAGAAGCGGGGAGG - Intergenic
1158744036 18:60176934-60176956 ACCTAGTTGCAGGAGAAGGCAGG + Intergenic
1167209248 19:48122784-48122806 ACTCAGTTGCAGCAGGGGGCTGG + Intronic
1202696894 1_KI270712v1_random:132273-132295 ACGAAGGGGCAGAAGAGGGGAGG + Intergenic
925282040 2:2691414-2691436 ACTTGGTGGCAGATGAGGGAAGG - Intergenic
926278618 2:11425739-11425761 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
929401085 2:41582458-41582480 ACTCTGTTGCAGAATATGGGTGG - Intergenic
929484494 2:42341656-42341678 ACTTAGTTCCAGAGGAGGCAAGG + Intronic
931884289 2:66599126-66599148 ACTTAGCTGCAGGAGAGGCTGGG - Intergenic
932608232 2:73178209-73178231 AGTAAGTGGCAGAAGGGGGGGGG - Intergenic
934278054 2:91589287-91589309 ACGAAGGGGCAGAAGAGGGGAGG + Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
936876494 2:117195958-117195980 AATTAGTAACAGAAGCGGGGAGG + Intergenic
940543221 2:155048517-155048539 TCTTAATTTCAGAAAAGGGGAGG + Intergenic
941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG + Intronic
942662618 2:178282347-178282369 ACTAAGCAGCAGCAGAGGGGAGG - Intronic
942744895 2:179220758-179220780 TCTGAGTTGAAGAAGAGGAGAGG - Intronic
943604428 2:189960384-189960406 ATTAATTTGGAGAAGAGGGGAGG - Intronic
943796885 2:192007464-192007486 ATTTAGATGAAGAAGAGTGGTGG + Intronic
945726389 2:213475947-213475969 ACTTAAATGCAGAGGAGGGAAGG + Intronic
945982176 2:216321497-216321519 ACTGAGTTGGCAAAGAGGGGAGG + Intronic
948954198 2:241273880-241273902 ACTAAGTGGCAGGGGAGGGGAGG + Intronic
1169343532 20:4813320-4813342 AGTTGGTGGCAGAAGAGTGGCGG - Intronic
1171110861 20:22480885-22480907 ACTTACTGGCTGAAGTGGGGCGG - Intergenic
1172031073 20:31982564-31982586 ACTTAGTGTCAGAAAAGGGAAGG - Intronic
1173169009 20:40707364-40707386 ATTTATTTGCAGAAGAGCTGGGG + Intergenic
1174388487 20:50201323-50201345 CCTTAGGTGTGGAAGAGGGGTGG - Intergenic
1180901381 22:19375792-19375814 ACTGGGGTGAAGAAGAGGGGAGG + Exonic
1182494950 22:30699656-30699678 CCTTAATAGCAGAAGAGTGGGGG + Intronic
1183344611 22:37300524-37300546 ACCTAGTTGGGGAAGAGGTGGGG - Intronic
1183965087 22:41436759-41436781 ACTAAGATGAAGAAGGGGGGCGG - Exonic
950133540 3:10564372-10564394 ACTTAGCTGGAGAATAGGGATGG - Intronic
954300362 3:49697864-49697886 ACCTGGGTGAAGAAGAGGGGTGG - Exonic
955585278 3:60471118-60471140 CCTTTGTTTCAGAAGAGGAGAGG - Intronic
957853218 3:85838561-85838583 ACTTTTTTGGAGGAGAGGGGAGG + Intronic
959588439 3:108048759-108048781 ACTTTGCTACAGAAGAGGGCAGG + Intronic
960501754 3:118446136-118446158 AGTTAGTGGTAGAAGAGGAGAGG - Intergenic
960973458 3:123155258-123155280 ACTTACTTGGAGGAGAGGGATGG + Intronic
964066573 3:152587143-152587165 ACTTACTTGCATCAGAGTGGGGG + Intergenic
964548569 3:157861607-157861629 ACATAGAAGCAGAAGAAGGGTGG + Intergenic
964792153 3:160462478-160462500 ACTTAGTTCCAAAGGAGAGGTGG + Intronic
964818748 3:160746367-160746389 ATTTGGATGCAGAAGAGGAGAGG + Intergenic
965872821 3:173281025-173281047 GCTTATTAGCAGAAGAGGGTGGG + Intergenic
966051231 3:175619488-175619510 ACTTAAATGCAGAGGAGGGAAGG + Intronic
967787202 3:193510120-193510142 ACCAAGTTGCAGAGGAGGAGCGG + Intronic
968007963 3:195255846-195255868 ATTTAGCTGCAGAAGAGGTCTGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969032688 4:4227049-4227071 ACGAAGGGGCAGAAGAGGGGAGG - Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
974374438 4:61058313-61058335 ACTTTGTAGCAGTAGAGGGAGGG + Intergenic
975688490 4:76942623-76942645 ACTTAGCTGCAGAGGAGGCTAGG - Intergenic
975728024 4:77311185-77311207 AGTCAGTTGCAGTAGAGGGAGGG + Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
989518677 5:42375167-42375189 AGTTAGCGGCAGAAGAGGGTGGG + Intergenic
991557945 5:67916746-67916768 GCTTAGTAGCAACAGAGGGGAGG + Intergenic
992529046 5:77637966-77637988 AGTCCCTTGCAGAAGAGGGGGGG + Intronic
993087523 5:83381870-83381892 ACTTACCTGCAAAAGAGGGTGGG - Intergenic
993327769 5:86563848-86563870 ACAGAGTTGCACAAAAGGGGAGG + Intergenic
994245559 5:97471802-97471824 ACTTAAATGCAGAACAGGAGGGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
997566742 5:134893731-134893753 AGTTAGAAGCAGAAGAGGGGGGG + Intronic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999375506 5:151083816-151083838 AGCAAGTTCCAGAAGAGGGGTGG + Intronic
999441296 5:151602849-151602871 ACTTAATTGCAAAAGAGAGTGGG + Intergenic
999530638 5:152459515-152459537 ACTTAGCTGCAAAAGAGGAATGG - Intergenic
1003237637 6:4311296-4311318 ACTGATTTGCAGCAGAGAGGTGG - Intergenic
1004304985 6:14492431-14492453 AATTAGTTAGAGAAGAAGGGAGG + Intergenic
1005000005 6:21230889-21230911 ACTGAGATGCAGCAGAGGTGTGG - Exonic
1005682149 6:28218092-28218114 ACTAAGATGAAGAAGAGGGGTGG - Intergenic
1006425529 6:33960666-33960688 ACTGAGTTGAAGAAGGGTGGAGG - Intergenic
1006880457 6:37334332-37334354 ACCTAGTTGCAGGAGAGGTTGGG + Intergenic
1008077330 6:47158944-47158966 ACTTAGAGGTAGAAGAGGAGGGG + Intergenic
1013386424 6:109636216-109636238 GCTGAGTTGCAGGAGAGGAGGGG - Intronic
1013973537 6:116048721-116048743 AATTAGATGTAGAAGAGGAGAGG - Intronic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG + Intergenic
1016050301 6:139523639-139523661 AGCTGGTTGGAGAAGAGGGGTGG + Intergenic
1021931522 7:25585810-25585832 TCTGAATTGCAGAAAAGGGGTGG - Intergenic
1029353260 7:100030631-100030653 ACTGAGTGGCTGAAGAGGTGAGG - Intronic
1030017703 7:105241464-105241486 AAGTAGATGCTGAAGAGGGGTGG - Intronic
1030333836 7:108302400-108302422 ACTTTTTTGAAGAAGAGGAGTGG - Intronic
1035262208 7:157669226-157669248 ACTCCGTGGCAGAAGAAGGGAGG - Intronic
1037904949 8:22710785-22710807 AATTAAAAGCAGAAGAGGGGAGG + Intergenic
1039247818 8:35629003-35629025 TCTTTGATGCAGAGGAGGGGAGG + Intronic
1041248482 8:55911851-55911873 ACTGAGATGGAGAAGATGGGAGG + Intronic
1041771014 8:61472322-61472344 ACATAGTTTCTGGAGAGGGGAGG + Intronic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1043678345 8:82990041-82990063 ACATAGTTGCAGAGGAGAGCAGG + Intergenic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1046533723 8:115481402-115481424 GTTTTGTTGCAGAAGAGTGGGGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046668042 8:117026695-117026717 CCTTATCTGCAGAACAGGGGAGG + Intronic
1048027192 8:130597552-130597574 GCTTAGTTGGAGGATAGGGGTGG + Intergenic
1050526482 9:6550904-6550926 CCTTTGTTGCAGATGATGGGAGG - Exonic
1050918903 9:11174044-11174066 ACTTTGTTTCAAAAGAGGTGGGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056763315 9:89429403-89429425 TCTTAGCTGCAAAAGAGGGATGG - Intronic
1059819542 9:117956806-117956828 AATTAGTTGCAGAAGTAGGCAGG + Intergenic
1187281080 X:17859201-17859223 CCTTTGTTACAGTAGAGGGGTGG - Intronic
1187833829 X:23410390-23410412 GCTTGCTTGCAGACGAGGGGTGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1193584658 X:83306293-83306315 ACTGAGTTGGAGAAGAGGCAGGG - Intergenic
1195258880 X:103114149-103114171 AGTTAGTTGGAGATGAGGGTTGG - Intergenic
1197947149 X:131851756-131851778 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1200076756 X:153554970-153554992 ACTTGGTGGCAGCAGAGGGGTGG + Intronic
1200834289 Y:7717921-7717943 ACTGAGGTCCAGAAGAGGGAAGG + Intergenic