ID: 1148427534

View in Genome Browser
Species Human (GRCh38)
Location 17:47612461-47612483
Sequence TCATCTCGATGCACTCCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148427534 Original CRISPR TCATCTCGATGCACTCCTGA GGG Exonic
901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG + Intergenic
901993799 1:13135326-13135348 TCTCCTTGCTGCACTCCTGAGGG - Intergenic
902213061 1:14917406-14917428 TCATCTCCGTCCACTCCTGGGGG - Intronic
911906461 1:103574858-103574880 TCATTTAGAGGCACTCCAGAAGG - Intronic
911909967 1:103621228-103621250 TCATTTAGAGGCACTCCAGAAGG - Intronic
911913063 1:103660003-103660025 TCATTTAGAGGCACTCCAGAAGG - Intronic
911915392 1:103691945-103691967 TCATTTAGAGGCACTCCAGAAGG + Intronic
911917383 1:103715353-103715375 TCATTTAGAGGCACTCCAGAAGG - Intronic
911920475 1:103754142-103754164 TCATTTAGAGGCACTCCAGAAGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
923057571 1:230438694-230438716 CCAGCTCCAGGCACTCCTGAGGG - Intergenic
924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG + Intronic
1063703668 10:8410250-8410272 TCCTCTCGCTGCACTCCTGGAGG - Intergenic
1067246791 10:44554112-44554134 TCCGCTCCATGCACACCTGAGGG + Intergenic
1067837694 10:49651734-49651756 ACACCTCAGTGCACTCCTGAAGG + Intronic
1071254856 10:83862912-83862934 TCATCTCCATGACTTCCTGATGG - Intergenic
1074248049 10:111714175-111714197 TCATCTCTCTGCACTCTTGGGGG - Intergenic
1077076381 11:704258-704280 TCCGCTCGGTGGACTCCTGAGGG + Intronic
1078578834 11:12523427-12523449 TCATCCCAAGGCACTGCTGAAGG - Intronic
1080947847 11:36995072-36995094 TCCTCTCAATGCTCTCCAGAGGG - Intergenic
1087619403 11:100525223-100525245 TCCTCTGGCTGCCCTCCTGATGG - Intergenic
1101554067 12:105790725-105790747 TCATCACCATGCACTCCTGCAGG + Intergenic
1111853570 13:93607666-93607688 TCAGCTGGATGCACTCCTTTTGG + Intronic
1121447868 14:93989536-93989558 GCATCTGGATGAAATCCTGATGG - Intergenic
1122245960 14:100403824-100403846 TCATCTCGATGGAAGTCTGAGGG - Intronic
1136355692 16:29744001-29744023 TCATCTGGATGCGATCTTGAAGG + Exonic
1142158344 16:88543669-88543691 TTATCTCTCTGCACTCCTAATGG + Intergenic
1143910451 17:10244620-10244642 TCATCTCCATGCACTGCATAGGG + Intergenic
1146481996 17:33212270-33212292 TGATCTCAATGTAGTCCTGAGGG + Intronic
1148427534 17:47612461-47612483 TCATCTCGATGCACTCCTGAGGG + Exonic
1149021500 17:51971183-51971205 TCATTTCTAGGCACTCCTCATGG - Intronic
1150891303 17:69153347-69153369 TCATCTAGAAGCACCACTGATGG + Exonic
1151515530 17:74592583-74592605 TCCTCTCCCTGCACTCCTCATGG - Exonic
1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG + Intronic
1155685420 18:28542507-28542529 TCATCTTGATATAGTCCTGAAGG + Intergenic
1156666551 18:39415197-39415219 TCATCTTGATAAACTCCTTAGGG - Intergenic
1160765137 19:804285-804307 TCATCTCGATGAAGGCCTGTTGG - Exonic
925511752 2:4635000-4635022 TGAGATCGATGCACTGCTGATGG + Intergenic
926377982 2:12253072-12253094 TCTTCATGATGCACTCCTGCTGG - Intergenic
930646747 2:53917546-53917568 TCATTAGGATGCACTGCTGAAGG - Intronic
936242363 2:110798993-110799015 TGATCTCGATGCCTTCCTTAGGG + Exonic
945578774 2:211566022-211566044 TCATCTTGTTGCAGTCCTGGTGG - Intronic
946097059 2:217283693-217283715 TCATTCCCACGCACTCCTGATGG + Intergenic
946885772 2:224221102-224221124 GCATCTCCATGGACTGCTGAGGG - Intergenic
1170721101 20:18879723-18879745 TCCTCTGGTTGCCCTCCTGATGG + Intergenic
1172461149 20:35119771-35119793 TCATCTGGACCCACTCCTGTTGG - Intronic
1173103022 20:40105138-40105160 TCATCTCGATGACCTCATGCTGG - Intergenic
1174340490 20:49892144-49892166 TCATCTCGTTGGACTCTTTAAGG + Exonic
1174588228 20:51625119-51625141 TGATCTCCCTGCACTGCTGAGGG + Intronic
1182220408 22:28754086-28754108 TCGTGTCACTGCACTCCTGACGG + Intronic
1183312332 22:37117302-37117324 GCATCTCCATGTACTGCTGAGGG - Intergenic
957946378 3:87068516-87068538 TCATCTGGATCCACCTCTGATGG - Intergenic
967134451 3:186501716-186501738 TCATCTCCATGCCCTTCTGCAGG - Intergenic
969327658 4:6453140-6453162 TCATCTCCATCCACCCTTGAAGG + Intronic
973179675 4:47252109-47252131 TCCTCTGGATGCCCTCCAGATGG + Intronic
974905554 4:68051013-68051035 TAATCTCTGTGCAGTCCTGATGG - Intergenic
977733144 4:100379544-100379566 TCCTCTGGCTGCCCTCCTGATGG - Intergenic
993449808 5:88059706-88059728 TCATCTCAATTCAGGCCTGAGGG - Intergenic
1009912745 6:69952671-69952693 TCATCTCACTGCAGTGCTGAGGG - Intronic
1010502184 6:76614815-76614837 TCCTCTCAATGAACACCTGATGG - Intergenic
1012793665 6:103733942-103733964 TCCTCTGGCTGCCCTCCTGATGG - Intergenic
1022725221 7:32975210-32975232 TCATTTTGATGTACTTCTGATGG + Exonic
1023282209 7:38582419-38582441 TCATGTCCAGGCACCCCTGAGGG + Intronic
1025048381 7:55712635-55712657 TCATTTTGATGTACTTCTGATGG - Intergenic
1027830544 7:83171527-83171549 TCATCTCTAGTCACTTCTGAAGG - Intergenic
1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG + Intronic
1059204334 9:112449786-112449808 TCATGTCACTGCACTCCAGACGG + Intronic
1188057223 X:25555263-25555285 TCATCAGCATGCTCTCCTGAAGG + Intergenic
1192979125 X:76319542-76319564 TCATCTGGACACCCTCCTGATGG + Intergenic
1197132320 X:123019715-123019737 TCCTCTGGCTGCCCTCCTGATGG - Intergenic
1201299542 Y:12493955-12493977 TCCTCACGCTGCAATCCTGATGG - Intergenic
1201917875 Y:19202301-19202323 TAATCTCCATGCACTCTTGATGG - Intergenic