ID: 1148432022

View in Genome Browser
Species Human (GRCh38)
Location 17:47650226-47650248
Sequence CGCCGCCGCCACCTCCGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 0, 2: 22, 3: 218, 4: 606}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148432015_1148432022 13 Left 1148432015 17:47650190-47650212 CCCGAAAGGCCGGGCCGTCGTCT 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606
1148432009_1148432022 29 Left 1148432009 17:47650174-47650196 CCAGTTCGAGCCGCCGCCCGAAA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606
1148432008_1148432022 30 Left 1148432008 17:47650173-47650195 CCCAGTTCGAGCCGCCGCCCGAA 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606
1148432020_1148432022 -1 Left 1148432020 17:47650204-47650226 CCGTCGTCTTAGGAGGAGTCGCC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606
1148432014_1148432022 16 Left 1148432014 17:47650187-47650209 CCGCCCGAAAGGCCGGGCCGTCG 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606
1148432016_1148432022 12 Left 1148432016 17:47650191-47650213 CCGAAAGGCCGGGCCGTCGTCTT 0: 1
1: 0
2: 1
3: 3
4: 28
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606
1148432013_1148432022 19 Left 1148432013 17:47650184-47650206 CCGCCGCCCGAAAGGCCGGGCCG 0: 1
1: 0
2: 0
3: 2
4: 94
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606
1148432019_1148432022 4 Left 1148432019 17:47650199-47650221 CCGGGCCGTCGTCTTAGGAGGAG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG 0: 1
1: 0
2: 22
3: 218
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148432022 Original CRISPR CGCCGCCGCCACCTCCGCCA TGG Exonic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
900512975 1:3069053-3069075 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
900988353 1:6086238-6086260 AGCCCCCGCCCCCTCCCCCATGG + Intronic
901454672 1:9356229-9356251 TGCCGTCGCCACCCCCACCACGG - Exonic
901628974 1:10639029-10639051 CGCCGCCTCCGCCGCCGCCTCGG + Exonic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
902385047 1:16071735-16071757 CTCCACCGCCCCCTCTGCCAGGG - Intronic
902771395 1:18647223-18647245 CTCCGCCGCCACTGCCGCCTGGG + Intronic
902783105 1:18716960-18716982 CGCCGCCCCAACCCCCGCCCTGG - Intronic
902823241 1:18956236-18956258 CGCCGCCGCCGCCCCCGCCAGGG + Exonic
902896893 1:19485435-19485457 CGCCGCCGCCGCCGCCACCATGG - Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903828644 1:26161951-26161973 CGCCGCCGCCCGCGCCGCCCGGG - Exonic
903998316 1:27322235-27322257 CGCCGCCGCCACCCCCGCCCAGG + Exonic
904542098 1:31239949-31239971 CTCCGCCGCCGCCACCGACAGGG + Intergenic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904782936 1:32964401-32964423 CGCCGCCGCGGCCTCCGCCTCGG + Exonic
904822829 1:33256455-33256477 CGCCGCCGCCGCCGCCGCCTCGG + Intergenic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
905518318 1:38578409-38578431 CGCCGCCGCCCCCTCCTCTCTGG - Intergenic
906157434 1:43622017-43622039 CTCCTCCGCCACCCCCGCCGTGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906480949 1:46198469-46198491 CGCCGCCGCCGCCGCTGCCGCGG + Intronic
906614593 1:47225678-47225700 CGGCGCCGCCCCCACCGGCAGGG + Exonic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906650524 1:47509262-47509284 CCCTGCCCACACCTCCGCCATGG - Intergenic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
907069198 1:51518985-51519007 GGCCGCCGCGACCTCGCCCAGGG - Intronic
907946096 1:59137933-59137955 GGCCTCTGCCACCTCCTCCAGGG - Intergenic
908951669 1:69568662-69568684 CCCCGCAGCACCCTCCGCCACGG - Intronic
910210056 1:84783347-84783369 CCCCGCCCCCACCTCTCCCAGGG + Intergenic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
910759003 1:90717598-90717620 CGCCGCCGCCGCCGCTGCCGGGG + Intergenic
911188648 1:94927145-94927167 GGCCGCCCCCGCCTCCGCCTGGG + Exonic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912515070 1:110211988-110212010 CGCCGCTGCCGCCTCCGTCCGGG - Exonic
912911058 1:113759413-113759435 TGCCGCCGCCTCCTCCTCCCGGG - Exonic
913565562 1:120069428-120069450 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
913615720 1:120558171-120558193 AGCCGCCGCCGCCGCCGCCTCGG - Intergenic
913632568 1:120724125-120724147 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914237334 1:145823950-145823972 CGTCGCCGCCGCCGCCGCCTCGG + Exonic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
914386273 1:147172645-147172667 CGCCGCCGCCGCCGCCTCGATGG + Intergenic
914428602 1:147600196-147600218 CGCCGCCGCTGCCGCCGCCGGGG + Intronic
914574556 1:148952731-148952753 AGCCGCCGCCGCCGCCGCCTCGG + Intronic
914619316 1:149390799-149390821 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915322160 1:155062038-155062060 CGCCACGGCCACCACCGTCATGG - Intronic
915913793 1:159929637-159929659 CGCCGCAAGCGCCTCCGCCAAGG - Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
917923417 1:179769673-179769695 TGCCACTGCCACCTCTGCCACGG - Intronic
920022702 1:202967385-202967407 CGCCGCCGCCACCTCCTGCTAGG - Intergenic
920302455 1:204997339-204997361 TGCTGCCGCCACCACCACCACGG + Exonic
920705009 1:208244298-208244320 CGCCGCCGCCGCCGCCACCGCGG - Exonic
920878427 1:209858738-209858760 CGCCTCCCCCACCCCCGCCGTGG - Intergenic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922558193 1:226548927-226548949 CGCCGCCGCCGCCGCCGTCTCGG - Exonic
922776133 1:228214994-228215016 CTCCTCCGCCACATCAGCCACGG - Exonic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
923400779 1:233614078-233614100 CGCCGCCCCCGCCCCCGCCCGGG - Exonic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924577237 1:245291787-245291809 TGTCACCGCCACCTCCTCCATGG - Intronic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1063663655 10:8049724-8049746 CACCGCCCCCTCCTCCGCCTCGG - Intergenic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064645374 10:17454334-17454356 CGCCGCCGCCACCGCCGCCGTGG + Intergenic
1065023093 10:21516899-21516921 CGCCGCCGCCGCCGCCGCCTTGG + Exonic
1065099939 10:22322006-22322028 CGCCGCCGCCCGCTCAGCCCCGG + Intronic
1065189811 10:23198905-23198927 CGCCGCCGCCTCAGCCTCCACGG - Intergenic
1065214887 10:23439535-23439557 CGCCGCCGCTACCCCCTTCAAGG + Exonic
1065589781 10:27252570-27252592 CGCCCCCGCCGCCGCCGCCAGGG + Intergenic
1066094071 10:32056197-32056219 CGCCGCCGCTGCCGCCGCCATGG - Exonic
1066464626 10:35641336-35641358 CGCTGCGGCCGCCTCGGCCAAGG - Exonic
1068751443 10:60597564-60597586 CGCCTCCTTCACCTCCCCCAAGG + Intronic
1069360059 10:67632342-67632364 AGCCGCCGCCATCTACCCCAGGG - Intronic
1070257922 10:74826669-74826691 CACCGCTGCCGCCGCCGCCAGGG - Exonic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1070768400 10:79069211-79069233 CGCCGCCGCCACCGCCGGGTAGG - Exonic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1070844667 10:79512529-79512551 CGCCGCCGCCGCCTCTACCCAGG - Intergenic
1070929136 10:80247779-80247801 CGCCGCCGCCGCCTCTACCCAGG + Intergenic
1071086966 10:81875748-81875770 CCCCGCCACCCCCTCCGCCGGGG + Exonic
1071661157 10:87504652-87504674 CGCCGGCTCCACCTCAGCCACGG + Intergenic
1072562232 10:96586897-96586919 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1072679705 10:97498352-97498374 CGCCGCCGCCTCCACAGCCGCGG + Exonic
1072710652 10:97713851-97713873 CGCCGCCGCCACCGCGCCCAGGG + Exonic
1072719501 10:97771932-97771954 AGCCGCCGCCGCCGCCGCCGCGG + Exonic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072793439 10:98336081-98336103 CGAGGCAGCCACTTCCGCCACGG + Intergenic
1073032223 10:100535945-100535967 CGCCGCCATCTCCGCCGCCAGGG - Exonic
1073052908 10:100680922-100680944 GGCCGCCGCCACCTCTGTCCAGG - Intergenic
1074503360 10:114045014-114045036 CGCCGCCGCCACCGCCCCGCTGG + Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074865724 10:117543429-117543451 CGCCGCCGCCGCCGCCGGTAGGG + Exonic
1075401392 10:122163768-122163790 TGCCGCCGCTCCCGCCGCCACGG + Intronic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1075645440 10:124093259-124093281 CGCCACCGCCACCACCGCGCCGG + Intronic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1075802148 10:125160359-125160381 CGCCGCCGCCGCCGCCTCCAGGG - Intronic
1076373072 10:129967281-129967303 TGCCGCCGCCGCCTCCTCCTCGG + Intergenic
1076373074 10:129967284-129967306 CGCCGCCGCCTCCTCCTCGGAGG + Intergenic
1076548250 10:131260370-131260392 CACCGCCGCCGCCGCTGCCATGG - Exonic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076878678 10:133229845-133229867 CGCCCCCGCCGCCCCCGCCCGGG - Intergenic
1076898554 10:133325869-133325891 CGCCGCCTCCTTCTCCGCCTTGG + Exonic
1076898573 10:133325920-133325942 CGCCGCCGCCGCCCCAGCCTGGG + Exonic
1077074674 11:694964-694986 CGCCGCCGCCACAGCGGCCGCGG + Exonic
1077207176 11:1350218-1350240 TGCCTCCTCCACCTCCCCCAGGG + Intergenic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077393224 11:2309293-2309315 CGCAGCCTCCACCCCCTCCACGG + Intronic
1077495918 11:2886344-2886366 CGCCGCTGCCAGCTCGGCCCTGG + Intergenic
1078313628 11:10272247-10272269 CGCCGCCGCCATGTCCTCCGGGG - Intronic
1079237104 11:18698868-18698890 AGCCGCCGCCGCCGCCGCCATGG + Exonic
1079353682 11:19713641-19713663 CGCCCCCGCCGCCGCTGCCAGGG + Exonic
1079451204 11:20601262-20601284 CGCCGCCGCCACGTGTGCCCAGG + Exonic
1081871032 11:46382527-46382549 CGCGGCCCCGCCCTCCGCCAAGG - Intronic
1082928902 11:58579230-58579252 CGCCTCCGCCTCCGCCGCCTAGG + Exonic
1083335062 11:61917435-61917457 GCCCGCCGCCGACTCCGCCAGGG + Exonic
1083562164 11:63681635-63681657 GGCCGCCGACGGCTCCGCCATGG - Exonic
1083617961 11:64035773-64035795 CCCCGCCGCCGCCGCCGCGAGGG + Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1084028447 11:66467037-66467059 AGCCCCCGCCCCCTCCGCCCCGG - Intronic
1084072382 11:66744804-66744826 CGCCGCCCCCTCCTCAGCCCGGG - Intronic
1084087569 11:66861615-66861637 CGCCCCCGCCCACTCCTCCATGG - Intronic
1084129034 11:67119339-67119361 CGCCGCCGCCGCCGCTGCCGGGG - Intronic
1084785855 11:71441264-71441286 TGCCGTCTCCACCTTCGCCATGG - Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1086315636 11:85589059-85589081 CGCCCCTGCCACCTCCAACAGGG - Intronic
1086322337 11:85664287-85664309 CGCCACCGCCGCCTCCTCCTGGG + Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1087039488 11:93784677-93784699 CCCCGCCGCCTCCTCCTCCTCGG - Exonic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1088595085 11:111435352-111435374 CACCACCGCCACCACCGCCACGG + Intronic
1089494988 11:118903300-118903322 CGCCCCCGCCCCCGCCCCCAGGG + Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090086456 11:123654621-123654643 CTCCGCCACCACCACCGCCCCGG + Intronic
1090788581 11:130070364-130070386 CGGCGCCGCCACCTCCTCCGGGG + Intronic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558582 12:1594165-1594187 CGCCGCCGCCGCCGCCGCCTCGG + Exonic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1092172828 12:6384272-6384294 AGCCGCCGCCACCGCTGCCCAGG + Exonic
1092518439 12:9240414-9240436 CGCAGCCGCCTCCGCCGCCGCGG - Intergenic
1092727680 12:11500714-11500736 CGCTGCCGCCGCCACCGCCGGGG + Intronic
1093958794 12:25250908-25250930 CGCCGCCGCGGCCGCCGCCTAGG + Intronic
1094041121 12:26122641-26122663 CGCCGCCGCTGCCGCCGCCGCGG + Exonic
1094375449 12:29783897-29783919 CTCCGCCGCCGCCTGCGCCGCGG + Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1094653429 12:32399389-32399411 CGCCGCCGCCTCCTCCGGCCGGG - Intergenic
1096396500 12:51270183-51270205 CGCCGCAGCCACCTCGGCCGTGG - Intronic
1096489713 12:52006956-52006978 AGCCGCCGCCAGCCCCGCCGAGG + Exonic
1096491418 12:52015025-52015047 CCCCGCCTCCGCCCCCGCCAGGG - Exonic
1096541248 12:52308528-52308550 CGCCTGCGCCCCCTCCGCCCGGG + Exonic
1096590040 12:52651986-52652008 AGCCCCCGCCACCACCACCATGG + Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097107671 12:56634956-56634978 CGCCGCCGCCGCCTGCGGCCCGG - Intronic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1098787388 12:74776714-74776736 CCCCACCGCCCCCACCGCCATGG + Intergenic
1099989765 12:89709325-89709347 CGCCGCCGCCGCTGCCGCCTTGG + Intergenic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1100565559 12:95790683-95790705 CGCCGCCGCCGCCTCCTCCTGGG + Exonic
1100632286 12:96400589-96400611 CGCCTCCGCCGCCGCCGGCAGGG - Intergenic
1100869443 12:98894981-98895003 CGCCGCCGCCGCTGCCGCCAGGG - Intronic
1101023151 12:100573681-100573703 CGCCGCTGCCGCCGCCGCCTGGG - Intronic
1101371890 12:104138033-104138055 CCCCGCCGCCAACGCCGCCGCGG - Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605872 12:106247560-106247582 CGCCGCCGCCGCCTCGTCCTCGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1101612432 12:106303414-106303436 CTCCGCCGTCCCCTCCCCCAAGG + Intronic
1101910518 12:108857543-108857565 CGCCACCGCCACCGCCGCCCGGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1103377718 12:120469649-120469671 CGCCGCCGCCGCCTCAGCACGGG + Exonic
1103386287 12:120534835-120534857 CGCCGCCACCGCCTCCGACATGG + Exonic
1103521249 12:121537912-121537934 AGCCGCCGCCGCCGCCGCCGAGG - Intronic
1103779401 12:123389116-123389138 CGCCGCCACCAGCGCCGCCGCGG - Intronic
1103779525 12:123389451-123389473 CGCCGCCGCCTCCACCGCGCGGG - Exonic
1103954256 12:124567597-124567619 CGCCGCCGCCACCGCCGCCGCGG - Intergenic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1105217475 13:18297570-18297592 CGCCGCCACCAGCGCCGCCGCGG - Intergenic
1105217511 13:18297711-18297733 CGCCGCCGCCTCCACCGCGCAGG - Intergenic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106512392 13:30422377-30422399 CGCTGCCACCACCGCCGCCGCGG - Intergenic
1107467839 13:40665925-40665947 CGCCGCCACCGCCGCCGCCACGG + Exonic
1107603971 13:42040644-42040666 CGCCGCCTCCTCCTTCTCCACGG - Intronic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107771005 13:43787298-43787320 CGCTCCCGCCACCGCCGCCGCGG + Intergenic
1108555191 13:51584642-51584664 CGCCGCCGCCAACCGCGCCGCGG - Exonic
1108648803 13:52455634-52455656 CGCCACCGCCACCGCCACCGCGG - Intronic
1109284855 13:60397594-60397616 CGCCGCCGCCGCCGCCTCCAGGG - Intronic
1110705934 13:78602167-78602189 CGCCACCGCCGCCTCCCCCGGGG + Exonic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1113794720 13:113050625-113050647 CACCGCCCCCACCGCCCCCACGG - Intronic
1114037907 14:18646471-18646493 CGCCGCCGCCGCCTCCCGAAAGG + Intergenic
1115320819 14:32077370-32077392 CGCTGCCGCCGCCACCGCCGGGG + Exonic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1115399238 14:32939129-32939151 CGCCGCCGCCGCCACGGCCACGG + Intronic
1115399317 14:32939415-32939437 CGCCGCCGCCTCCGCCGCCGAGG + Intronic
1116452879 14:45084134-45084156 AGCAGCCGCCACCCGCGCCACGG - Exonic
1116518768 14:45827174-45827196 CGCCCCCGCCCCCTCCCCCCTGG - Intergenic
1118258579 14:64226334-64226356 CCCCGCCCCCACCCCCGCCGTGG - Exonic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118607762 14:67515629-67515651 CACCGCAGCCACCTGCGCCGCGG - Intronic
1118849476 14:69573079-69573101 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1118971506 14:70641918-70641940 AGCCGCCGCCGCCGCCGCCTCGG - Exonic
1119003979 14:70907797-70907819 CGCCGCCGCCGTCCCCGCCCCGG - Exonic
1119286380 14:73458339-73458361 CGCCCCCGCCGCCTCCGCCCTGG + Intronic
1119438518 14:74612764-74612786 CAGGGCCGCCAGCTCCGCCAGGG - Intergenic
1119497349 14:75091440-75091462 CGCCCCCGCCGCCTCCTCCCGGG + Exonic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1120521826 14:85533681-85533703 CTCCGCCACCACCGCCTCCAGGG - Intronic
1121103329 14:91264653-91264675 CTCCGCCGCCCACCCCGCCACGG + Intergenic
1121279385 14:92688180-92688202 CGCCGCCGCCACCACCGTCCAGG - Exonic
1121287607 14:92748502-92748524 CGCCGCCACCACTGCCACCACGG - Exonic
1121342913 14:93115779-93115801 CGCCGCCGCCACTTCCTCCTCGG + Exonic
1122108761 14:99480799-99480821 CGCCACCGCCGCCACCGCCTGGG - Exonic
1122130812 14:99603927-99603949 CGCCGCCGCCGCCGTCGCCGCGG + Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122558296 14:102592970-102592992 CGCCGCCTCCGCCGCCGCCTCGG + Exonic
1122558313 14:102593030-102593052 CGCCGCCGCCTCCTCAGCCTCGG + Exonic
1122658471 14:103278993-103279015 CGCGACCGCCTCCTCCGCCCCGG + Intergenic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1202940080 14_KI270725v1_random:137507-137529 TGCCGCCGCCGCCACCGGCACGG - Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1124971146 15:34490544-34490566 CGCCGCCGCCGCCTCCGTGCTGG + Intergenic
1125042572 15:35208199-35208221 CTCCCCCGCCACCACCTCCAGGG - Intergenic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1126143022 15:45452924-45452946 CCCCGCCCCCCCCTCCCCCACGG - Intergenic
1126392889 15:48178240-48178262 CGCCGCCGCTGCCTCCGCCTCGG + Exonic
1126849868 15:52790365-52790387 CGCCGCCGCCGCCGCCGCAGCGG + Intronic
1127415031 15:58749551-58749573 CGCCGCCGCCGCCTCCTCACGGG + Exonic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1128455034 15:67827375-67827397 CGCCGCCGCTGCCGCCGCCACGG - Intronic
1129178903 15:73859283-73859305 CGCCCCCCCCACCCCCGTCAGGG + Intergenic
1129274032 15:74433783-74433805 GGCGGCCGCCGCCTCCGCCCAGG - Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130564420 15:84981685-84981707 CGCCGCCGCCGCCGCCTCCCCGG - Intronic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132398296 15:101489776-101489798 CGCCGCCGCCAACACCGCCGCGG + Exonic
1132398312 15:101489806-101489828 CGCGGCCGCCTCCTCCTCCCCGG - Exonic
1132426744 15:101724352-101724374 CGCCACGGCCTCCGCCGCCAGGG + Exonic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132747676 16:1443734-1443756 CGCCGCCGCCTCCGCCTCCACGG - Intronic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1132943805 16:2521137-2521159 AGCCCCCTCCACCTCAGCCAGGG - Intronic
1133011048 16:2912035-2912057 CGCCGCCGCCACCCCGACCCGGG - Exonic
1133259221 16:4537886-4537908 GGCCGTCGCCATCTCCGCCGGGG + Intronic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1133791614 16:9013408-9013430 TGCCGCCGCCTCCTCCTCCCGGG - Intergenic
1134849767 16:17470544-17470566 CGCCGCCTCCTCCTCCTCCTCGG + Exonic
1135023799 16:18983992-18984014 CGCCGCCGCCGCCGCCTCCCCGG - Exonic
1135158475 16:20073677-20073699 CGCCGCCGCCACCACCGAGCCGG - Exonic
1135296537 16:21283933-21283955 CGCCGCCGCCTCCGCCGCTGCGG - Intronic
1135536878 16:23301794-23301816 CGCCTCTTCCACCTCCACCAAGG - Intronic
1135554501 16:23424779-23424801 CGCCACCGCCCACTTCGCCAAGG - Exonic
1135691318 16:24539913-24539935 CCCCGCCGCCGCCGCCGCCTCGG - Intronic
1136110888 16:28063193-28063215 CGCCGCCGCCGCCACCGCCTCGG - Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136546529 16:30958013-30958035 CGCCGCCGCCGCCACCGCTGCGG + Intronic
1137617783 16:49857294-49857316 CGCCGCCGCCACCACGGTCCGGG - Intronic
1137617787 16:49857300-49857322 CGCCGCCGCCGCCGCCACCACGG - Intronic
1138105709 16:54286209-54286231 CGCCGCCGCCGTCGCCGCCGCGG - Exonic
1138425961 16:56932226-56932248 CGACACCGCCGCCGCCGCCATGG + Exonic
1139364881 16:66427172-66427194 CGCCGCCGCTGCCTCGGCCCGGG + Intergenic
1139615365 16:68085387-68085409 AGTCGCCGCCACCGCCGCCGCGG - Intronic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1140753665 16:78048554-78048576 CGCCGGCTCCAGCTCCACCAAGG - Intronic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141079151 16:81035805-81035827 CGCCGCAGCCACTTCCGGCAGGG - Intergenic
1141079180 16:81035878-81035900 CGCCGCCGCCGCCGCCTCCGAGG - Exonic
1141972431 16:87492712-87492734 CGCCGCCCGCGCCTCCGCCCAGG + Intergenic
1142163334 16:88570628-88570650 CGCGGCCGCCGCCGCCGCCTCGG - Intronic
1142221429 16:88856857-88856879 CGCCGCGACAACCGCCGCCATGG + Exonic
1142418379 16:89955408-89955430 AGCAGCCCCCACCTCAGCCAGGG + Intronic
1142695192 17:1629340-1629362 CGCCGCCGTCCCCGCCGCCTCGG + Intergenic
1143021986 17:3921621-3921643 CGCTGCCTCCACCCCCGCCCAGG - Intergenic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1143633397 17:8151295-8151317 CGCCGCCGCCACGGTCGCCAGGG + Intronic
1143676493 17:8436387-8436409 CGCCGCTGCCACCTCCGACTGGG - Intronic
1144021350 17:11241652-11241674 CGCCGCCGCCACAGCCGCCGCGG - Exonic
1144910058 17:18673038-18673060 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1145183662 17:20775465-20775487 CGCCGCGGCCACCGCTGCCGAGG + Intergenic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1147110336 17:38257031-38257053 CGCCGCCGCCTCCACAGCCTGGG - Intergenic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147720378 17:42536271-42536293 GGCCACCGCCACCGCCTCCATGG - Exonic
1148035448 17:44656487-44656509 CGCAGCCGCCTCCGCCGCCCGGG - Exonic
1148079459 17:44959859-44959881 CGCCGCCGCGACCTCTCCCCAGG + Exonic
1148206736 17:45784261-45784283 CGCCCCCGCCACCTCCCCCACGG - Intronic
1148262251 17:46193585-46193607 GGCCGCCGCCGCCTCAGTCATGG + Intronic
1148419174 17:47531400-47531422 CGCCGCCGCCTCCACAGCCTGGG + Exonic
1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG + Exonic
1148664098 17:49361919-49361941 CGCCTCCGCCTCCGCCGCCCCGG + Intronic
1148786739 17:50149440-50149462 CGCCGCCGCCTCCTTCTCCGGGG + Exonic
1148844202 17:50519129-50519151 TGCCCCCGCCCCCTCCTCCATGG - Intronic
1150216606 17:63474997-63475019 CTCCGCCTCCACTTCCGACAGGG - Intergenic
1150239880 17:63622741-63622763 CGCCGCCGCCATCGCCACCATGG + Exonic
1150373505 17:64661883-64661905 CCCCGCCGCCCCCGCCGCCGGGG - Exonic
1150423167 17:65056596-65056618 TGCCGCCGCCGCCGCCGCCTCGG + Exonic
1150802278 17:68291597-68291619 CGCCCCCGCCAGCGCCGCCGGGG + Intronic
1151755335 17:76072449-76072471 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1152049141 17:77958950-77958972 CGCCGCCGCCGCCGCCGCCTAGG + Intergenic
1152077509 17:78168586-78168608 CGCCGCCGCTGCCGCCGCCGCGG - Exonic
1152114738 17:78378664-78378686 AGCTGCCGCCGCCACCGCCATGG - Exonic
1152232048 17:79118647-79118669 CCCCTCCTCCACCTCCTCCAAGG + Intronic
1152352053 17:79789755-79789777 CGCCGCCGCGACCTGCCCGAGGG + Intergenic
1152353635 17:79796791-79796813 TGCCGCCGCCGCCGCCGCCACGG + Intronic
1152353638 17:79796797-79796819 CGCCGCCGCCGCCACGGCCGCGG + Intronic
1152777591 17:82212590-82212612 CCCCGCCGCAGCCTCCGCGAGGG + Intronic
1152834381 17:82519887-82519909 CGCCGCCGCGGCCGCCGCCATGG - Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155007356 18:21741078-21741100 CGGCGCCGCCTCCTCCCCCGTGG - Intronic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1156088810 18:33440756-33440778 CGCCGCCGCCGCCGCCCCCGCGG - Intronic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1157610535 18:48952315-48952337 CGCCACCGCCACCCCCTCCCGGG + Intergenic
1158137595 18:54224229-54224251 AGCCGCCGCCGTCGCCGCCAAGG + Exonic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1158976515 18:62715793-62715815 CGCCGCCGCCAGAGCCGCCGCGG - Exonic
1160053158 18:75455619-75455641 CGCAGCCCCCACCGCCGACAGGG - Intergenic
1160100625 18:75916679-75916701 CGCCTCCCCCACCTGCGCGAAGG + Intergenic
1160735859 19:662250-662272 CGCTGCTCCCACCTCCCCCAAGG + Intronic
1160873102 19:1285888-1285910 CGCCGCCGCCGCACCCGCCGGGG - Intergenic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930699 19:1568301-1568323 CGCCGCCGCCTCGGCCGCCGAGG - Intergenic
1161080595 19:2308160-2308182 CGCCGCCGCCGCCGCCTCCCGGG + Intronic
1161165591 19:2785550-2785572 AACCGCCGCCACCGCCGCCACGG - Exonic
1161241159 19:3224704-3224726 CGCCGCCGCCGCCGCCGGCTCGG + Exonic
1161328057 19:3672882-3672904 CCCCGCCCCCACCGCCTCCAGGG - Intronic
1161400705 19:4065462-4065484 CGCCGCCACCGCCGCCGCCGGGG - Intronic
1161487635 19:4544254-4544276 CACCGCCACCGCCTCCGCCCCGG + Exonic
1161703062 19:5805318-5805340 CGCGGCCGCCCCCTCCGGCCCGG + Intergenic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162470872 19:10871484-10871506 CGCCGCCGCCACCGTCGCCGCGG - Intergenic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162805341 19:13135401-13135423 AGCCGCCGGCAGCTCCACCACGG - Exonic
1163154474 19:15432492-15432514 CGCCACCGCCACCGCCGCCGCGG - Intronic
1163158137 19:15449914-15449936 CGCCGCCGCCTCCACCGCTCGGG + Exonic
1163289452 19:16369994-16370016 CGCAGACGCCACCTCTGCAAAGG + Intronic
1163473478 19:17511654-17511676 CCCCGCCGCCGCCCTCGCCATGG + Exonic
1163583703 19:18153176-18153198 CCCCGCCTCCGCCGCCGCCACGG - Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163607223 19:18281886-18281908 CCCCGGCGCCGCCTCCGCCAAGG + Intergenic
1163631348 19:18419471-18419493 CGCCGCTGCCGCCGCCGCCGCGG + Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1163847029 19:19643614-19643636 CGCAGCCGCCGCCGCCGCCTCGG + Exonic
1165411518 19:35665356-35665378 CTCAGTCCCCACCTCCGCCAGGG + Intergenic
1165431418 19:35775582-35775604 CGTCGCCGCTGCCGCCGCCATGG - Exonic
1165510969 19:36266525-36266547 CACCGCCGCCACCGCCGCCCCGG + Intergenic
1165628099 19:37289381-37289403 CTGCGCCGCCACCGCCGCCACGG - Intergenic
1165721551 19:38082687-38082709 CGCTTCCGCCGCCTCGGCCATGG + Exonic
1165758048 19:38305394-38305416 CTGCGCCGCCGCCACCGCCATGG + Exonic
1165760080 19:38315922-38315944 CGCCGCCGCCACCTAAGCCGCGG + Exonic
1165924947 19:39320955-39320977 CGCCGCCACCGCCGCCGCAAGGG + Intergenic
1166039274 19:40192030-40192052 CGCCCCCTCCTCCTCCTCCATGG - Exonic
1166211650 19:41310318-41310340 CGCCGCCGTCGCCGTCGCCACGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166759511 19:45215864-45215886 CTCCGCCGCCACCGCCACCAGGG - Intronic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166852852 19:45768698-45768720 CGCCGCCGCCGCCTCACCCTCGG + Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1167637947 19:50666401-50666423 CACCGCCACCACCTCTGCCCGGG - Exonic
1168148994 19:54435048-54435070 AGCCACCGCCAGCTCCGCCTTGG - Intronic
1168152350 19:54455891-54455913 AGCCGCCACCACCTCCCTCAAGG - Intronic
1168339335 19:55614530-55614552 CACCGCCGCCGCCCCCTCCACGG + Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
1168721769 19:58558393-58558415 CGCCGCCGCTGCCGCCGCCGCGG + Exonic
925162790 2:1697757-1697779 CCACGCCGCCACATCTGCCAGGG - Intronic
926101413 2:10120665-10120687 CGCCGCCACCTCCTCCGCAGCGG + Intergenic
927213146 2:20650938-20650960 GGCCGCCGCCTCCTAGGCCAGGG - Intronic
927215827 2:20667356-20667378 CGCCGCCGCCGCCGCCCCCTGGG - Exonic
927652481 2:24920595-24920617 CGCCGCCCCCTCCTCCGCCGCGG + Intergenic
927696795 2:25244762-25244784 CCCCGCCACCACCTTAGCCAGGG + Intronic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
928549518 2:32357286-32357308 CGCCCCCGCCCCCGCCGCCGAGG - Exonic
929188733 2:39120790-39120812 CCCAGCCGCCAGCTCCGCCGCGG - Intronic
929775836 2:44929933-44929955 TCCCGCCGCCTCCTCAGCCAAGG - Intergenic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
930096637 2:47570870-47570892 CGACGCCGCCAGCTCAGCCCCGG - Exonic
931253393 2:60551853-60551875 CGCCGCCGCCGCCTGCTCCGGGG + Intronic
931254111 2:60555286-60555308 AGCCGCCGCCGCCGCCGCCGGGG + Intergenic
931614594 2:64143840-64143862 CGCGGCCTCCCCCTCCGCCCGGG - Intronic
931657591 2:64524368-64524390 CGCCTCCTCCACCTCCTCCGCGG - Exonic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
932699856 2:73985079-73985101 CGCCGCCGCCACCACCGTCGCGG - Intergenic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933684614 2:85133427-85133449 CGCCGCCGCCTGCTCCGCCGGGG - Exonic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934079114 2:88452454-88452476 CGCCGCCACCGCCGCCGCCCCGG - Exonic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934296829 2:91749078-91749100 TGCCGCCGCCACCAGCGCCGCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934538831 2:95158734-95158756 CATCCCCTCCACCTCCGCCACGG + Intronic
934882404 2:97995596-97995618 CGCCGTCTCCACGTCCGCCGGGG - Exonic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
935692615 2:105744881-105744903 CGCCGCCGCCGCCGCTGCCGCGG + Exonic
937044984 2:118846532-118846554 CGCCGCCGCCACTGCCGCCGCGG + Exonic
937395444 2:121530617-121530639 CGCCCCCGCCAGCCCCGCCCCGG + Intronic
938273047 2:129992620-129992642 TGCCGCCGCCGCCTCCCGCAAGG - Intergenic
938443177 2:131353486-131353508 TGCCGCCGCCGCCTCCCGCAAGG + Intronic
939629760 2:144517172-144517194 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
940112627 2:150171190-150171212 CCCCCGCCCCACCTCCGCCATGG - Intergenic
940775080 2:157876290-157876312 CGCCGCCGCAGCCTCCCCCTCGG - Intergenic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
941686840 2:168456303-168456325 CGCCGCCGCCGCCTCCTCCGCGG - Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942278193 2:174337443-174337465 CGCCGCCGCTGCCGCCGCCCGGG - Exonic
942446158 2:176080283-176080305 CGCCGCCGCCACCGCCACCCCGG + Exonic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
942450919 2:176107631-176107653 CGCCGCCGCCGCCCCCGCCGGGG - Exonic
942578606 2:177392788-177392810 TGCAGCCGCCGCCTCCGCCATGG - Exonic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945314950 2:208360860-208360882 AGCGGCCGGCACCTCCACCATGG - Intronic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946322247 2:218960852-218960874 CGCCGCCTCCTCGGCCGCCAGGG + Exonic
946688797 2:222295696-222295718 GGCCGCCGCCACCTGGCCCAGGG - Intronic
946921430 2:224585161-224585183 CGCCGCCCCCGCCGCCGCCGCGG - Exonic
947117930 2:226791637-226791659 CCCGCCCGCCACCACCGCCAGGG + Intronic
947521663 2:230850259-230850281 CGCCTCCACCGCCCCCGCCAAGG - Intergenic
947523787 2:230866398-230866420 CTCCGGCGCCCCCTCCTCCAGGG - Intronic
947635998 2:231681050-231681072 CGCCGCCGCCATCTGCGCCGGGG - Intergenic
947742405 2:232490708-232490730 CGTGGCCGCCACAGCCGCCACGG + Intergenic
947792640 2:232876820-232876842 CGGCGCCGCCTCCTCTGCCTGGG + Intronic
947913984 2:233820064-233820086 GGCCGGGGCCACCTCCTCCAGGG - Intronic
948415332 2:237798820-237798842 CGCCGCCGCTGCCGCCTCCACGG - Exonic
948487251 2:238288752-238288774 CAGCGCCGCCGCCTCCGCCGCGG + Intronic
948983807 2:241508306-241508328 CGCCGCCCCCACCTCTTCCAAGG + Intronic
949014490 2:241701873-241701895 CGCTGCCACAACCTCCGCCCGGG + Intergenic
1169129696 20:3159729-3159751 GGCCGCCGCGACCTCCTCCCCGG + Intronic
1169171827 20:3471349-3471371 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1169800338 20:9507089-9507111 CGCCGCCGCCTCCGCCGCCTGGG + Intergenic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1170999441 20:21397462-21397484 CGTCGCCGCCACCTCGGCCGCGG + Exonic
1171011502 20:21511858-21511880 CCTCGCCGCCACCGCCGCCGGGG + Exonic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1172037308 20:32019118-32019140 CGCCGCCGCCTCCCCCGGCCCGG - Exonic
1172091273 20:32434650-32434672 CCCCGCCGCCACCTCCACCCGGG - Exonic
1172474460 20:35226680-35226702 CGCCGCCGCCGCCGCCGCCTCGG - Exonic
1172603267 20:36197996-36198018 CCCCGCCTCCCCCTCCCCCAAGG + Exonic
1172764810 20:37345871-37345893 CCCCGCCTCCCACTCCGCCAGGG - Intronic
1172793401 20:37521330-37521352 GGCCGCCGCCACTGCCGCCATGG - Exonic
1172951263 20:38724706-38724728 CGCTGTCCCCACCGCCGCCATGG + Exonic
1173221965 20:41138167-41138189 CGACGCCGCCACCACTCCCAGGG - Intronic
1173548169 20:43914873-43914895 CGCCGCCGCCGCGCCCGCCATGG + Exonic
1173596949 20:44264571-44264593 TGCAGCCCCCACCTCCCCCAGGG - Intronic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1173820160 20:46014280-46014302 CGCCGCCGCGGCCGCCGGCAGGG + Intronic
1173831227 20:46089862-46089884 CGCCGCTGCCGCCTCCGCGTCGG + Exonic
1174287771 20:49484198-49484220 AGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1174317463 20:49713761-49713783 GGCCGCCGCCGCCACCGCCTGGG + Exonic
1174330408 20:49812964-49812986 CCCCGCCGCCTCCGCCGCCCGGG - Intronic
1174494729 20:50931307-50931329 CGCCGCCGCCTCCGCCGGCCCGG - Intergenic
1174607042 20:51768467-51768489 TGCCGCCGCCTCCTCCCCCGGGG - Exonic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847236 20:62065366-62065388 CGCCGCCGCCGCCGTCGCCGCGG - Exonic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1175856278 20:62122541-62122563 GCCCGCCGCCGCCTCCGCCTGGG - Exonic
1175975758 20:62709651-62709673 CGACGCCTGCACCTACGCCACGG + Exonic
1176016799 20:62938111-62938133 CCCCGCCCCCGCCTCCGCCGCGG + Exonic
1176180418 20:63747136-63747158 CCTCGCCGCCTCCGCCGCCATGG + Exonic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176583093 21:8549542-8549564 TGCCGCCGCCGCCACCGGCACGG + Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178673907 21:34614955-34614977 CGCCTCCGCCGCCTCCGCCGCGG + Exonic
1178695702 21:34791893-34791915 CGCCTCGGACACCTCCGCGAGGG + Exonic
1178914471 21:36699023-36699045 CGCCGCCCCCGCCCCCGCCGCGG + Intergenic
1178983304 21:37283220-37283242 CGCCGCCCCCTGCTCCACCACGG - Intergenic
1179561595 21:42219239-42219261 CGCCGCCGCCGCCGCCCCCGGGG + Exonic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179884127 21:44306229-44306251 CGCCGCCCCAACCTCTGCCACGG - Intronic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1180265897 22:10526472-10526494 TGCCGCCGCCGCCACCGGCACGG + Intergenic
1180462034 22:15573513-15573535 CGCCGCCGCCGCCTCCCGAAAGG + Intergenic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181478022 22:23180564-23180586 CGCCGCCGCCGCCGCCTCCTCGG - Exonic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1181725145 22:24806279-24806301 CACCGCCGCCACCGCCTCCTGGG + Intronic
1181934620 22:26429610-26429632 CGCCGCCGCCGCCCCCGCCGAGG + Intronic
1182236952 22:28883653-28883675 CGCCGCCGCCGCCGCCGTGATGG + Exonic
1182586357 22:31346196-31346218 CGCCGCCGCCACCGCCCTCCAGG - Exonic
1183187501 22:36300389-36300411 TGCCGTCCCCACCTCAGCCATGG - Intronic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183517091 22:38272893-38272915 CGCAGACGCCGCCACCGCCATGG - Exonic
1184086865 22:42270563-42270585 GGCGGCCGCGGCCTCCGCCAGGG - Intronic
1184330105 22:43821812-43821834 TGCAGCCGCCACCCCAGCCAGGG - Intergenic
1184423656 22:44396337-44396359 CCTCCCCGCCACCTCCCCCATGG - Intergenic
1184620298 22:45671810-45671832 CGCCGGCGCCCCCTCCCCCGCGG + Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1184927082 22:47650541-47650563 TGCCTCCGCCACCTCTGCCTGGG + Intergenic
1185055267 22:48575868-48575890 CGCCGCCGCCACCGCCGCCGCGG - Intronic
1185229469 22:49671872-49671894 CGGAGCCGCCCCCTCCGCCCTGG - Intergenic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
949970242 3:9397672-9397694 CGCCGCCGCCGCCGCTGCCGGGG + Intronic
950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG + Intronic
950976749 3:17254754-17254776 CCCCCCCCCCACCCCCGCCACGG - Intronic
951217700 3:20040420-20040442 AGGCGCCGCCGCCGCCGCCAGGG - Exonic
951717527 3:25664849-25664871 AGCCGCCGCCGCCGCCGCCACGG + Intronic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952504900 3:33998823-33998845 CCCCACCGCCACCTCCACCCTGG - Intergenic
953684345 3:45064619-45064641 CTCCACCCCCACCTCCCCCACGG - Intergenic
953705054 3:45225154-45225176 CGCCGCTGCCGCCGCCGCCGCGG - Exonic
953705144 3:45225514-45225536 CGCCGCCGCCGCCACCGCCGGGG - Exonic
953748712 3:45594074-45594096 CTCGGCCGCCCCCTCCGCCCCGG + Intronic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
954338443 3:49934359-49934381 CGCCTCCGCCTCCACCTCCAGGG - Intergenic
954437441 3:50503532-50503554 CGCCGCCGCCTTCTCCGCGAGGG + Intronic
954540763 3:51391746-51391768 CGCCGCCTCCGCCACCGCCTGGG + Exonic
954540873 3:51392242-51392264 CGCCGCCGCAGCCTTCGCCCTGG + Exonic
954649846 3:52154369-52154391 CGGCGCCGCCAGCCCCGCCATGG - Exonic
955228418 3:57079270-57079292 CGCCGCAGCCGCCGCCGCCGCGG - Exonic
955768562 3:62369043-62369065 CGCCGCCGCCGCCGCCTCCTGGG - Intergenic
955911535 3:63863787-63863809 CGCCGCCGCCGCGCACGCCATGG - Exonic
955911560 3:63863888-63863910 CGCCGCCGCCTCCTCCTCCATGG - Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
955916501 3:63912744-63912766 AGCACCCGCCACCGCCGCCACGG + Exonic
956659154 3:71582371-71582393 CGGCGCCGCCGCCACCGCCGTGG + Intronic
956677997 3:71753588-71753610 CGCCGCCGCCAGCCCCGCCGAGG - Intronic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
956678072 3:71753853-71753875 CGCCGCCGCCATCTCAGGAATGG - Intronic
957663367 3:83190383-83190405 CGCCCCCTCCACCCCTGCCAAGG + Intergenic
957792463 3:84958927-84958949 CCCCGCCCCCACCCCGGCCAGGG - Intergenic
958798830 3:98733237-98733259 CGCCGCAGCCACCGCCGAGAGGG + Intronic
958814485 3:98901245-98901267 CGCGGCCGCCGCCCCCGCCTGGG - Exonic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
961858248 3:129893663-129893685 CGCCGCCGCCGCCTCAGCCCCGG + Intergenic
962793991 3:138835006-138835028 CGCCGCCGCCGCCGCCACCGCGG - Intergenic
963171193 3:142252687-142252709 CTCCCCTGCCACCTCCACCAGGG + Intergenic
963870725 3:150410550-150410572 CGCCGCAGCGAGCCCCGCCACGG + Exonic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966653587 3:182327733-182327755 CCCCGCCCCCACCTCACCCAAGG - Intergenic
966911423 3:184562258-184562280 CGCCGCCGTCGCCGCCGCCGGGG + Exonic
966915794 3:184583596-184583618 CGCCGCCGCCAGCTGTGCCAGGG - Intronic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968506375 4:973128-973150 CGCCGGTGCCACCTCCGCTCAGG + Intronic
968640500 4:1712219-1712241 CGCCGCCGCCGCCTCAGCCTCGG - Exonic
968659700 4:1793916-1793938 CGCGGCCCCCGCCCCCGCCATGG + Exonic
968674713 4:1871346-1871368 CGCCGCCGCCGCCGCAGCCGGGG - Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968835889 4:2963903-2963925 CGCCGCCACCACTGCCACCAAGG - Exonic
969087653 4:4668318-4668340 TGCCGGCGTCACCTCCTCCAGGG + Intergenic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970456240 4:16226632-16226654 TGCCGCCGCCGCCGCCGCCACGG + Intronic
971457864 4:26861030-26861052 CGCCCCCGCCGCCTCAGACACGG - Exonic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
972621231 4:40750033-40750055 CTTCGCCGCCACGTCCGCGAAGG + Exonic
975342630 4:73258765-73258787 CGCCTCCGCCGCCACCGCCTCGG + Exonic
976226398 4:82798275-82798297 CGCCGGCGCCCCCTGCGCCCCGG - Intronic
976431410 4:84966517-84966539 CGCCGCCGCCGCCTCAGCCTCGG + Intergenic
977257546 4:94757912-94757934 CGCCGCCGCCGCCGCCACCGCGG - Intergenic
978072539 4:104491322-104491344 CGCCGCCGCCACCGCCGGCGGGG + Exonic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
979349665 4:119628964-119628986 CGCCGCCGCCGCCGCCTCCTGGG - Exonic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
979785647 4:124712702-124712724 CGCCGCCGCCGCCGCCGTCAGGG + Exonic
980130066 4:128809971-128809993 CGCCGCCGCCGTCGCCGCCGCGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
982042347 4:151408989-151409011 CGCCGCCGCCAGGTGCGCCGGGG - Intergenic
985696698 5:1344954-1344976 CGCCACCGCCACCGCCGCGGGGG + Exonic
986496730 5:8349725-8349747 CGCAGGAGCCACCTCCTCCAGGG + Intergenic
986717395 5:10533878-10533900 CGCCCCCTCCACCTCTGCCCTGG - Intergenic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
986858966 5:11904306-11904328 CGCCGCCGCCTCAGCCGCCGAGG + Intergenic
987087973 5:14487495-14487517 CGCCGCCGCCGCCCCCGCTGTGG - Exonic
988437531 5:31193807-31193829 CTCCGCCGCCGCCGCCGCCGCGG - Exonic
988547792 5:32174285-32174307 CGCCGCCGCCGCCTCCGCCTTGG - Exonic
988825323 5:34929736-34929758 CGCCGCCGCCGCCGCCGCTTCGG + Exonic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
989103328 5:37839694-37839716 CGCCGCCGCCGCCGCCAACAGGG + Intergenic
989638015 5:43556854-43556876 CTCCTCCGCCTCCTCCTCCAGGG + Exonic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990557735 5:56952171-56952193 AGCCGCCGCCGCCACCGCCGCGG + Intronic
990825429 5:59893356-59893378 CGCCGCCCCCGCCGCCGCCCGGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992528100 5:77630656-77630678 CGCCGCCGCTGCCGCCGCCATGG - Exonic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994353892 5:98774097-98774119 CGCCGCCGCTGCCGCCGCCGAGG + Exonic
995106327 5:108381292-108381314 CGCCGCCGCCGCTGCCGCCTCGG - Exonic
996937411 5:128965193-128965215 CCCCGCCGCCAGCTCCTCCCTGG - Exonic
997479740 5:134176467-134176489 CCCCGCCGCCACCCCCGCCCTGG + Intronic
998236491 5:140402395-140402417 CACCGCGGCCACCGCCGCCATGG - Intronic
1000302890 5:159972052-159972074 CGCCGCCGCCGCCGTCGCCTGGG + Exonic
1000319027 5:160119161-160119183 CGCCGCCACCGCCGCCGCCGGGG - Exonic
1001470206 5:172006551-172006573 CGCCGTCGCCTCCTCCGCCCGGG - Exonic
1001556562 5:172641238-172641260 CGCCGCCGCCGCCTCCCTCCCGG + Intergenic
1002006443 5:176238464-176238486 CGCCGCCGCCGCCACTGCCTGGG + Exonic
1002212805 5:177608638-177608660 CCCCGCCGCCACCTCAGCTGCGG + Intronic
1002219934 5:177672172-177672194 CGCCGCCGCCGCCACTGCCTGGG - Intergenic
1002447062 5:179296218-179296240 CCCTGCCGCCACCTCCTCCATGG - Intronic
1002591074 5:180291981-180292003 CGCCGCCGCCGCCGCCGCAGTGG + Exonic
1002710249 5:181190867-181190889 CGCCGCCTCCACCTGTGCCCAGG + Intergenic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003206947 6:4021387-4021409 AGCCGCCGCCACCGCCGCCGAGG + Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1003645531 6:7910642-7910664 CGCCGCCGCCGCCGCCTCCTGGG + Exonic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004561841 6:16760124-16760146 CGCCGCCGCCTCCTCCTACGTGG - Intronic
1004690224 6:17987282-17987304 CGCGGACGCCGCCTCCGCCCCGG + Intronic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1004924052 6:20402373-20402395 CGCCGCCGCTGCCGCCGCCCCGG + Exonic
1005040306 6:21595029-21595051 CGCCGCCGCCGCCGCCCCCATGG - Exonic
1006022569 6:31126063-31126085 GCCCACTGCCACCTCCGCCAAGG - Intronic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1006337544 6:33428237-33428259 CGCCGCCGCCGCCGCCACCGCGG - Intronic
1006491590 6:34392549-34392571 CGCCGCCGCTGCCACCGTCACGG + Exonic
1006547514 6:34792123-34792145 CACAGCCGCCGCCGCCGCCATGG - Exonic
1006642707 6:35497086-35497108 CGCAGCCCCCACCCCCGCCCCGG - Intergenic
1006725402 6:36196504-36196526 AGGCGCCGCCGCCGCCGCCACGG - Intergenic
1007665354 6:43510144-43510166 CGCCGCCGCCGCGACCGCGAGGG - Exonic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1010569966 6:77464129-77464151 CGCCGCCGCCACCGCCACCCTGG + Intergenic
1010703262 6:79077616-79077638 CGCCGCTGCCGCCGCCGGCAGGG - Intronic
1011762859 6:90587008-90587030 CGCTGCCTCTACCCCCGCCACGG - Exonic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013117808 6:107115543-107115565 CGCGGCCGCCGCCCCCGCCCCGG - Intergenic
1015148925 6:130018507-130018529 CGCCGCCGCCGCCGCTGCCGGGG - Exonic
1017021412 6:150143111-150143133 CGCCGCTACCACCTCCGGCCCGG - Exonic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1017672416 6:156779293-156779315 CGCCCCCGCCGCCGCCGCCTGGG - Exonic
1017891581 6:158644194-158644216 CGCCGCCAGCCCCTCCGCCCCGG - Intronic
1018400377 6:163414786-163414808 CGCCGCCGCCGCCTGTGCCGCGG - Exonic
1018613075 6:165662247-165662269 CGCCGCTGCCACCGCCGCCGCGG + Intronic
1018613384 6:165663200-165663222 CGCCGCCACCACCGCCTCCACGG - Intronic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019111974 6:169724109-169724131 CAGCGCCGCCGCCACCGCCATGG + Intronic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019493227 7:1324657-1324679 CCCTGCAGCCACCTCCTCCAGGG - Intergenic
1019498628 7:1353061-1353083 CGCCGCCGCCACCCAGGCCGAGG - Intergenic
1019568609 7:1697332-1697354 CGCCCCTGCCCCCTCCTCCACGG + Intronic
1019989586 7:4682395-4682417 CGCCGCCGCCGCCTTCCCCGCGG + Exonic
1020727341 7:11832145-11832167 CGCCGCCGCCGCCTCTGGCGGGG + Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021600217 7:22356977-22356999 TGCCGCCACCACCGCCGCCGCGG + Intronic
1021827916 7:24573272-24573294 CGCCGCCGCCGCCGCCGCTTGGG - Intronic
1022100253 7:27165155-27165177 CGCCGCCGCCACGGGCGCCTGGG + Exonic
1022101095 7:27169613-27169635 CGCCGCTGCCGCCGCCGCCAAGG + Intronic
1022485012 7:30771384-30771406 CGCCGACGCCGCCGTCGCCACGG + Intronic
1023418147 7:39950845-39950867 CGCCGCAGCCGCCGCCGCCGCGG + Exonic
1023881879 7:44325409-44325431 CGCCGCCGCCATGGCCACCACGG - Exonic
1024023657 7:45392341-45392363 TGCTGCCGCCACCGCCGCCTGGG - Intergenic
1025007520 7:55365944-55365966 CCCCGCCGCCGCCTCCTCCGAGG - Exonic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1025947373 7:66114876-66114898 CGCCGCCACCAACAGCGCCAAGG - Exonic
1026734802 7:72942762-72942784 CACCCTCGCCACCTCCGCCCCGG + Exonic
1026785136 7:73297674-73297696 CACCCTCGCCACCTCCGCCCCGG + Intergenic
1027108941 7:75422256-75422278 CACCCTCGCCACCTCCGCCCCGG - Exonic
1027390279 7:77696904-77696926 CGCCGCCGCCGCCGCTGCCTCGG + Exonic
1027421154 7:78019488-78019510 CGCCGCTGCCGCCGCCGCCCGGG + Exonic
1028173721 7:87628859-87628881 CGCCTCCGCCGCCACCGCCGCGG - Exonic
1029123195 7:98281726-98281748 CGCCGCCGCGTCCCCCGCCGGGG + Exonic
1029456216 7:100673840-100673862 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1029456218 7:100673843-100673865 CGCCGCCGCCTCCGCCGCGGAGG + Exonic
1029715131 7:102321546-102321568 CGTGGCCGCCACCGCCGCCGAGG + Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032054363 7:128672640-128672662 CCCCGCCCCCCCCTCCCCCAGGG - Intronic
1032119313 7:129144953-129144975 CGCCGCCGCCACCGCCCCCGGGG - Exonic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1032215281 7:129952691-129952713 CGCCGCCGCCGCCCCCCGCACGG + Exonic
1032530438 7:132615399-132615421 AGCCCCCGTCCCCTCCGCCAGGG - Intronic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034436828 7:151066519-151066541 CGCCTCCGCCTCCTCCACCTGGG - Exonic
1034455462 7:151167653-151167675 CCCCGCCGCCACCTCGGCCCGGG - Intronic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034910520 7:154994088-154994110 CACCGCCGACACCTCATCCAGGG + Intronic
1035169498 7:157009829-157009851 CGCAGCCGCCGCCGCCGCCGCGG + Exonic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1037273629 8:17156237-17156259 CGCCACCGCCCGCTCCGCCCCGG + Exonic
1037535224 8:19817434-19817456 CGCCGCCGCCGCCACCGCGGGGG - Exonic
1037535228 8:19817437-19817459 CGCCGCCGCCGCCGCCACCGCGG - Exonic
1038256353 8:25954691-25954713 CGCCCCCGCCCCTTCCCCCAGGG + Intronic
1038296161 8:26292043-26292065 CCCCACCCCCACCCCCGCCACGG - Intronic
1038883617 8:31640112-31640134 GGCCGCCGCCCCCGGCGCCAGGG - Intronic
1039502676 8:38030208-38030230 CGCCGCCCCCAACCCAGCCAAGG + Intergenic
1040065592 8:43141294-43141316 CGCCGCCGCCGCCGCCGCCTGGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041919800 8:63168834-63168856 CGCCGCCGCCGCCGCTGCCTGGG - Exonic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042040035 8:64580732-64580754 CGCTGCCGCCGCCGCCGCCTCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044405825 8:91824928-91824950 CACCACCGCCACCTCCAGCAAGG + Intergenic
1044744778 8:95361574-95361596 GGCCTCCTCCACCTCCGTCATGG + Intergenic
1044821883 8:96160715-96160737 CGCCGCCGCCACCGCCTCCTGGG - Exonic
1044832259 8:96261852-96261874 CGGCGCCGCCACCGCGGCCTGGG - Exonic
1045112704 8:98949155-98949177 CGCCGCCGCCATCTCCGTGATGG - Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1046770365 8:118111688-118111710 CGCCGCCGCCGCCTCCAGCCGGG - Exonic
1047124784 8:121948352-121948374 CCCCGCCCCCGCCCCCGCCATGG + Intergenic
1048009379 8:130443676-130443698 CGCCGCGGCCTCCTCCCCCTCGG - Intergenic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1048968416 8:139630396-139630418 CGCCGCCGCCCCCACCTCCCCGG + Intronic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049166426 8:141128706-141128728 CGGCGACGCGGCCTCCGCCATGG - Exonic
1049419478 8:142510578-142510600 CGCCGCCCCCAGCTCCTCCGGGG - Intronic
1049419815 8:142511538-142511560 CACCGCCACCTCCTCCTCCACGG - Intronic
1049705628 8:144040773-144040795 CTCCCCCACCACCTCCCCCACGG + Exonic
1049726300 8:144148048-144148070 AGCCGCCGCCACCTCGGCCGGGG - Intronic
1049788438 8:144462373-144462395 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
1049788442 8:144462382-144462404 CGCCGCCGCCTCGGCCGCCTCGG + Intronic
1050343317 9:4662459-4662481 TGCCGCCGCCACCGCCGCCATGG - Exonic
1050437929 9:5629199-5629221 CGCCGCCGCCGCCGCCGACTCGG + Exonic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1052862868 9:33447527-33447549 CGCCGCCGCCTGCCCCGCCATGG - Exonic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1053188239 9:36037048-36037070 CACCTCCGCGACCCCCGCCACGG - Exonic
1053381191 9:37650828-37650850 CGGCGCCGCGACCCCCGCCCCGG - Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054407652 9:64774845-64774867 CGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1054762310 9:69014089-69014111 CCCTGCCGCCGCCACCGCCATGG - Exonic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1055611890 9:78031962-78031984 CGCCGCCGCCTCCTCCCTCCCGG - Intergenic
1056143571 9:83707676-83707698 CGCCGCCGCCGCCACAGCCATGG - Exonic
1056387787 9:86113298-86113320 CACCACCGCCACCACCACCACGG + Intergenic
1056475396 9:86947234-86947256 CGCCGCCGCCACCGCCGCCGCGG + Intergenic
1057225629 9:93291673-93291695 CGCTGCTGCCACCTTCCCCACGG + Intronic
1057245758 9:93452474-93452496 CGCTGCCCCCAGCGCCGCCACGG - Exonic
1057463750 9:95292345-95292367 CGCCGCCGCCACCGCCTCCGAGG - Intronic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1058885685 9:109320200-109320222 CTCCGCCGCCGGCGCCGCCAAGG - Exonic
1058885718 9:109320302-109320324 GGCCGCCGCCGCCTCCTCCTCGG - Exonic
1059123308 9:111661625-111661647 CGCCGCCGCCATGTCCTCCGGGG + Exonic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1059668603 9:116472767-116472789 CGCCGCCGCCACCACCAACATGG - Intronic
1060468705 9:123930054-123930076 CGCCGCCGCCGCCGCCTCCAGGG + Exonic
1060514583 9:124257941-124257963 CGCCGCCGCCACCGCCTGCGCGG - Exonic
1060588111 9:124799449-124799471 CGCCCCTGCCACCCCTGCCACGG + Exonic
1060700474 9:125746546-125746568 CGCCGCCGGCACCGCCCCCGGGG - Intergenic
1060700612 9:125746961-125746983 CGCCGCCGCTGCCTCCCCCGGGG + Intergenic
1060790527 9:126482795-126482817 GGGCGCTGCCACCTCGGCCAGGG + Intronic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1061293609 9:129665876-129665898 CGCGGCCGCCGCCTTCGCCCTGG + Exonic
1061437999 9:130579047-130579069 GGCCACCGCCACTTCCGCCTGGG - Intronic
1061540733 9:131276910-131276932 CGCCGCCGCCTGCTTCGCCGCGG + Intergenic
1061624216 9:131831609-131831631 CGCTGCCCCCGCCTCCACCAAGG - Intergenic
1061842496 9:133367464-133367486 CGCCGCAGCCACCTCACCCTTGG - Intronic
1062326956 9:136017118-136017140 CGCCACCGCCACCGCCACCAGGG + Intronic
1062574559 9:137200208-137200230 CGCCGCCGCCCGCGCCGCCCCGG - Exonic
1062629972 9:137459145-137459167 CGCGCCCGCCGCCTCCGCCGGGG + Exonic
1062653368 9:137589951-137589973 CGTGGCCTCCACCTCCGGCAGGG + Intronic
1062658062 9:137614342-137614364 CGCACCCTCCACCTCCGCAATGG - Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203613074 Un_KI270749v1:27407-27429 TGCCGCCGCCGCCACCGGCACGG + Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185610591 X:1391937-1391959 CGCCGCCGCCATCTCCAAGACGG - Exonic
1186426032 X:9464997-9465019 CGCCGCCGGCCCCTCCCTCACGG - Exonic
1187181434 X:16946860-16946882 CGCCGCCGCTGCCGCCTCCATGG - Exonic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1187547313 X:20266716-20266738 CGCCGCCGCCGCCGCTGCCGTGG - Exonic
1187826177 X:23334757-23334779 CGCCGCCGTCGCCGCCGCCGCGG + Exonic
1187915419 X:24149373-24149395 CGCCGCTGCCGCCGCCGCCTCGG - Intronic
1189002787 X:36963738-36963760 CCCCGGCCCCACCTCCGCCGCGG + Intergenic
1189324667 X:40105336-40105358 CGCCGCCGCCGCCGCAGTCACGG + Intronic
1189325281 X:40107780-40107802 GGGCGCCGCCACCCCAGCCAGGG - Intronic
1189332316 X:40151718-40151740 CGCCGCCGCCGCCACCGCTGCGG - Intronic
1189423206 X:40875152-40875174 CCCCTCCCCCACCTCCACCAAGG + Intergenic
1189821501 X:44873426-44873448 CGCCGCCTCCTCCTCCGCCGCGG - Intronic
1190285373 X:48957713-48957735 CGCCGCCTCCTCCGCCGCCGAGG - Intronic
1190286162 X:48962655-48962677 CGGCCCTGCCACCGCCGCCAGGG + Exonic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1192657063 X:73003284-73003306 CTCCGCCACCGCCTCTGCCACGG - Intergenic
1192665057 X:73079717-73079739 CTCCGCCACCGCCTCTGCCACGG + Intergenic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196016355 X:110944462-110944484 GGCCGCCGCCACCACCGCTGCGG + Intronic
1197766155 X:130060573-130060595 GGCCGCGGCCGCCTCCGCCAGGG + Intergenic
1198051632 X:132957454-132957476 CGCCGCAGCCGCCGCCGCCGTGG - Intronic
1198767093 X:140091339-140091361 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200074043 X:153542534-153542556 CTCAGCCTCCACCTCCACCAGGG + Intronic
1200123866 X:153804114-153804136 CGCTGTTGCCACCCCCGCCAAGG - Exonic
1200151866 X:153955104-153955126 CACCACCGCCACCTCCAACATGG - Exonic
1200165109 X:154030492-154030514 CGCGGTTGCCACCGCCGCCACGG - Exonic
1200229538 X:154437163-154437185 CGCCGCCGCCGCCACCGCACTGG - Exonic
1200231085 X:154444217-154444239 CGCCGCCGCCGCCGCTGCCATGG + Exonic
1200292669 X:154887051-154887073 CGCCGCCGGCACCCCAGCCCGGG + Exonic
1200339513 X:155382791-155382813 CGCCGCCGGCACCCCAGCCCGGG + Exonic
1200346957 X:155457902-155457924 CGCCGCCGGCACCCCAGCCCGGG - Exonic