ID: 1148434411

View in Genome Browser
Species Human (GRCh38)
Location 17:47671320-47671342
Sequence CTGAACAATTCTAAGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148434411 Original CRISPR CTGAACAATTCTAAGGTAGG TGG (reversed) Intronic
903627794 1:24744093-24744115 CAGGACAATTCTGAAGTAGGTGG - Intergenic
907688263 1:56635582-56635604 TTGAACACTTTTAAGGAAGGAGG + Intronic
907821212 1:57971431-57971453 CTGAAAAATTATAAGGTACATGG + Intronic
912374798 1:109201376-109201398 CTGAGCAATTCTGAGCTGGGAGG + Intronic
913405852 1:118489812-118489834 CTGAACAATAGTAACTTAGGGGG - Intergenic
913594809 1:120365032-120365054 CTGAACAATTGCAAGGTAGCAGG + Intergenic
914306072 1:146419917-146419939 CTGAACAATTGCAAGGTAGCAGG + Intergenic
914595980 1:149152892-149152914 CTGAACAATTGCAAGGTAGCAGG - Intergenic
914787369 1:150846574-150846596 CAGCACAATTCTAAAGTAAGGGG + Intronic
923862578 1:237906096-237906118 CTGGACAATTCAGAGGTAAGAGG + Intergenic
924938359 1:248791337-248791359 ATGAACTATTCTAAGATAAGAGG - Intergenic
1064892459 10:20193049-20193071 CAGAATAATTCTAGGGAAGGGGG - Intronic
1065018053 10:21479584-21479606 CTGAACAAATCTAAAATATGTGG + Intergenic
1065361258 10:24891023-24891045 CTGAGAAATTCTCAGGAAGGTGG + Intronic
1065426735 10:25613909-25613931 ATGTACAATTCTAGGGTAGAAGG + Intergenic
1070922758 10:80198540-80198562 CTGAATCATTCTAATTTAGGAGG - Intronic
1073355189 10:102848269-102848291 CCTAACAGTTCTGAGGTAGGAGG - Intergenic
1074677307 10:115866256-115866278 CTGAACAATTATAAGGAGTGGGG + Intronic
1075176829 10:120172238-120172260 CTGAAGAATAGTAAGGTATGGGG + Intergenic
1078883305 11:15474924-15474946 CTGAAGGATGCTTAGGTAGGTGG - Intergenic
1089280634 11:117371909-117371931 CTGAACTATGATGAGGTAGGAGG - Intronic
1091006415 11:131957701-131957723 CTGAAATTTTCTAGGGTAGGAGG - Intronic
1091140109 11:133227587-133227609 CTGAGCAATTCTTAGGTTGCTGG - Intronic
1092192840 12:6533300-6533322 CTGAACACTTGTAAGGAAGGGGG - Intergenic
1093513585 12:19958067-19958089 CTGAAGAATTCTATTGTAGTTGG - Intergenic
1095338972 12:41065552-41065574 CTGAAGAATTCTGAGGAGGGTGG + Intronic
1099299458 12:80873775-80873797 CTGGACTATTCTAAGGTAAATGG + Intronic
1100500770 12:95172022-95172044 GGGAACAATTCTAAGGGGGGGGG + Intronic
1105655907 13:22438503-22438525 CTTAACAACTCTAAGGAAGTAGG - Intergenic
1108094304 13:46884419-46884441 CTAAACAAATCCAAGGTGGGCGG + Intronic
1116077198 14:40125785-40125807 CTGAACTATTCTTTGATAGGAGG - Intergenic
1116277414 14:42853370-42853392 CTGATCAATTCTAAAATAGGAGG - Intergenic
1116960006 14:50959517-50959539 CAGAACAACTCTAAGGTCAGTGG + Intergenic
1117539112 14:56729474-56729496 CTGGGAAATTCTAAGGTAGAAGG + Intronic
1125580952 15:40785322-40785344 TTCCACAATTCTAAGCTAGGAGG + Intronic
1126603497 15:50452442-50452464 TAGAACAAATCCAAGGTAGGGGG + Intronic
1128254088 15:66184584-66184606 TTGAAGGATTTTAAGGTAGGGGG - Intronic
1130607603 15:85331830-85331852 CTGAACACTCCTCTGGTAGGTGG - Intergenic
1133954668 16:10431593-10431615 CTGAACCATTCTTAGTGAGGTGG + Intronic
1139121913 16:64030093-64030115 CTATACATTTCTAAGGGAGGGGG + Intergenic
1139285722 16:65812011-65812033 CTGAATAATTCTAGGGGTGGGGG - Intergenic
1141997826 16:87646410-87646432 CTGAACATTTCTGAGGGAGCAGG - Intronic
1146519910 17:33518346-33518368 CTGAAAAAGGCTAAGGTTGGTGG + Intronic
1147326252 17:39671162-39671184 CTGAAAACTTTTAAGGTGGGAGG - Exonic
1147570279 17:41566271-41566293 CTGGACAATCCTGAGGTAGAAGG + Intronic
1148382455 17:47209789-47209811 CTGCACAAATCTAGGGTAGCAGG - Intronic
1148434411 17:47671320-47671342 CTGAACAATTCTAAGGTAGGTGG - Intronic
1151132889 17:71916486-71916508 TGGAACAATTCAAAGGTTGGGGG - Intergenic
1151329526 17:73398610-73398632 CTGAGAGATTCTAAGGCAGGAGG - Intronic
1157402454 18:47399868-47399890 CTGACCCATGCTGAGGTAGGGGG - Intergenic
1157644594 18:49254925-49254947 CTGAAAAACTCCAAGGTAGGAGG + Intronic
1161191756 19:2961267-2961289 CTGAAAAAGTCTTAGGTTGGGGG + Intergenic
925603505 2:5634378-5634400 CTGAACAATTGCAAGGTAGCAGG + Intergenic
929795978 2:45058654-45058676 CTGAAGAATTCCAGGGTAGACGG - Intergenic
930343345 2:50145796-50145818 CTGAAGACTTCTAAGGTTTGAGG + Intronic
932464626 2:71909466-71909488 CTGAACAATTCTAAGAGATCAGG + Intergenic
935717381 2:105951211-105951233 CTGAAGAATTCTAATCTTGGTGG + Intergenic
937703852 2:124895380-124895402 CTTTAGAATTCTAAGGTGGGAGG + Intronic
940749052 2:157603276-157603298 CTCAACAATTAAAAGGTAAGAGG - Intronic
946505285 2:220293864-220293886 CTGAAAAATACTAATGCAGGTGG + Intergenic
946536339 2:220633742-220633764 CTGAAAAATGCTCAGGTAGTGGG + Intergenic
946815551 2:223574630-223574652 CTAAAGAATTCTTCGGTAGGGGG - Intergenic
947919380 2:233855896-233855918 CTGAACACTCCTAAGGAAGGAGG - Intergenic
1170838167 20:19902649-19902671 CTGGGTAATTCTAAGGAAGGTGG + Intronic
1171027469 20:21644020-21644042 ATTAAGATTTCTAAGGTAGGAGG + Intergenic
1178129543 21:29556043-29556065 CAGAACCAGTCTAAGGTCGGTGG - Intronic
1183643834 22:39110624-39110646 CGGGACAACTCAAAGGTAGGAGG + Intergenic
1184789135 22:46688563-46688585 CCGAACAAGCCTAAGGGAGGAGG - Intronic
949314702 3:2739624-2739646 CTGAAAAATCCTAAGAGAGGAGG - Intronic
960036486 3:113107616-113107638 CTGCACAAGTCTAGGGAAGGAGG - Intergenic
964607985 3:158578719-158578741 GTGAGCAATTCTAAGAGAGGAGG + Intronic
966613027 3:181887067-181887089 CTGAACTATTCTCAGGTATTTGG - Intergenic
968373746 4:19577-19599 CTGTTCAATTCTGAGATAGGAGG + Intergenic
971279240 4:25227867-25227889 CTGAATAATTCAAATGTTGGAGG + Intronic
971922184 4:32955423-32955445 CTCAACAAATGAAAGGTAGGGGG + Intergenic
973746482 4:53968222-53968244 CTGAAGCATTCTGAGGTGGGAGG + Intronic
974308275 4:60171308-60171330 TTCAACAATTCTATGGAAGGAGG - Intergenic
982173591 4:152684296-152684318 CTGAATAATTCTAACATAGGTGG - Intergenic
982565660 4:156983666-156983688 CTCAACAATTCTAAAGAAGCTGG - Intergenic
983568270 4:169177009-169177031 CTAAAGAATGCCAAGGTAGGAGG - Intronic
985461639 4:190112974-190112996 CTGTTCAATTCTGAGATAGGAGG - Intergenic
986412700 5:7496997-7497019 CTGAACAATTCAAGTGTAGTTGG - Intronic
988582385 5:32479438-32479460 CTGAACAATTCTACTGCAAGAGG + Intergenic
990612185 5:57468654-57468676 CTCAACAATTCTGTGGTAGGTGG - Intergenic
999273591 5:150313468-150313490 CTGACACATTCTGAGGTAGGTGG - Intronic
1000412436 5:160947780-160947802 CAAAACTTTTCTAAGGTAGGTGG - Intergenic
1000626898 5:163548954-163548976 CTGATAATTTCTAAGTTAGGTGG + Intergenic
1002767185 6:252167-252189 CTGAACAATTCTAAGGAGGAAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007188610 6:39994700-39994722 CACAATAATGCTAAGGTAGGGGG + Intergenic
1008082282 6:47207117-47207139 CAAAACAATTATAAGGTGGGAGG + Intergenic
1008489645 6:52072806-52072828 CTGAGCATTTATAAGGTAGAAGG - Intronic
1009445203 6:63734205-63734227 CTGCATGATTCTAAGGTTGGAGG - Intronic
1012031701 6:94076553-94076575 CTGAACAGTTCTGTGGTTGGTGG + Intergenic
1013615924 6:111842943-111842965 GTAAACAATTCTAAGGCAGGAGG + Intronic
1014312741 6:119825408-119825430 CTGAACAATTCTTAGATAAAAGG - Intergenic
1017195473 6:151695539-151695561 CTGAACCAATCTAGGGGAGGAGG - Intronic
1017710738 6:157165336-157165358 CTGAAAGATTCTTAGGTATGAGG - Intronic
1021540481 7:21751753-21751775 CTGAGCAATTCTAGGTTAGAAGG + Intronic
1028578303 7:92378367-92378389 CTGAACCATTCTTATATAGGTGG - Intronic
1032741466 7:134743448-134743470 CTGAGCAAATCTAAGGGGGGTGG + Intergenic
1033284023 7:140025575-140025597 CTGCACCATTTTCAGGTAGGTGG - Intronic
1043099805 8:76029003-76029025 CTGGACAATTTTATGGTAGGGGG - Intergenic
1052606158 9:30704520-30704542 CTGAAAAGACCTAAGGTAGGAGG - Intergenic
1057474302 9:95385663-95385685 CTGAGGAATTCTAAGGCAGGAGG - Intergenic
1057911787 9:99025241-99025263 CTGAACCATTCGTAAGTAGGGGG - Intronic
1061679823 9:132237508-132237530 TTGAAGAATTCCAAGGTAAGAGG + Intronic
1188810113 X:34643175-34643197 CTGAACAAGACTAAGATATGGGG + Intronic
1195164280 X:102202927-102202949 CTGAACAATTCTATGAGAGTTGG - Intergenic
1195194580 X:102484168-102484190 CTGAACAATTCTATGAGAGTTGG + Intergenic
1196754389 X:119145265-119145287 CTGCAAAATTCTTTGGTAGGAGG + Intronic
1199975324 X:152891777-152891799 CTGGACTATTCTGAGGTAGCTGG + Intergenic