ID: 1148436823

View in Genome Browser
Species Human (GRCh38)
Location 17:47692127-47692149
Sequence CTAGTTCTGCTGCTCATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148436823_1148436831 19 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436831 17:47692169-47692191 ATCAGGTCCAGATTGGGGGAGGG No data
1148436823_1148436833 21 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436833 17:47692171-47692193 CAGGTCCAGATTGGGGGAGGGGG No data
1148436823_1148436830 18 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436830 17:47692168-47692190 GATCAGGTCCAGATTGGGGGAGG No data
1148436823_1148436829 15 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436829 17:47692165-47692187 TGAGATCAGGTCCAGATTGGGGG No data
1148436823_1148436827 13 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436827 17:47692163-47692185 AATGAGATCAGGTCCAGATTGGG No data
1148436823_1148436832 20 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436832 17:47692170-47692192 TCAGGTCCAGATTGGGGGAGGGG No data
1148436823_1148436826 12 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436826 17:47692162-47692184 CAATGAGATCAGGTCCAGATTGG No data
1148436823_1148436825 2 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436825 17:47692152-47692174 ATGGAGAATGCAATGAGATCAGG No data
1148436823_1148436828 14 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436828 17:47692164-47692186 ATGAGATCAGGTCCAGATTGGGG No data
1148436823_1148436834 24 Left 1148436823 17:47692127-47692149 CCTGGTATGAGCAGCAGAACTAG No data
Right 1148436834 17:47692174-47692196 GTCCAGATTGGGGGAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148436823 Original CRISPR CTAGTTCTGCTGCTCATACC AGG (reversed) Intergenic
No off target data available for this crispr