ID: 1148440480

View in Genome Browser
Species Human (GRCh38)
Location 17:47709245-47709267
Sequence TGCCCTCGAAGGCGCGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148440480_1148440488 21 Left 1148440480 17:47709245-47709267 CCCGCGGCGCGCCTTCGAGGGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1148440488 17:47709289-47709311 AGCCGTCGGAGGAGGACGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 138
1148440480_1148440487 13 Left 1148440480 17:47709245-47709267 CCCGCGGCGCGCCTTCGAGGGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1148440487 17:47709281-47709303 CGAGAAGCAGCCGTCGGAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 233
1148440480_1148440489 22 Left 1148440480 17:47709245-47709267 CCCGCGGCGCGCCTTCGAGGGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1148440489 17:47709290-47709312 GCCGTCGGAGGAGGACGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 150
1148440480_1148440486 10 Left 1148440480 17:47709245-47709267 CCCGCGGCGCGCCTTCGAGGGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1148440486 17:47709278-47709300 CTTCGAGAAGCAGCCGTCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 60
1148440480_1148440485 7 Left 1148440480 17:47709245-47709267 CCCGCGGCGCGCCTTCGAGGGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1148440485 17:47709275-47709297 GCGCTTCGAGAAGCAGCCGTCGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148440480 Original CRISPR TGCCCTCGAAGGCGCGCCGC GGG (reversed) Exonic
905226609 1:36482985-36483007 TGCCCTCGAAGGCGCAAGGGAGG - Exonic
905370788 1:37481758-37481780 TGACCTCCAAGGCGAGCGGCAGG + Exonic
906525439 1:46490746-46490768 TGCCCTCGAAGACGCGGCCTTGG + Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
917141637 1:171841463-171841485 CGCCCGCGCAGGCGCGCTGCGGG + Intergenic
1097679056 12:62632238-62632260 TGCCCTCAAGGTCGCGGCGCAGG - Intergenic
1103926918 12:124428259-124428281 GGCCCTCGAAGGCTGGGCGCCGG - Intronic
1103954696 12:124569405-124569427 TGCCCTCGAGGGCTCCCTGCAGG + Intergenic
1105896144 13:24718666-24718688 TGCCCTCACAGCCGCGCTGCAGG - Intergenic
1122399653 14:101459058-101459080 GGCCCTGGAAGGAGCCCCGCGGG + Intergenic
1122789344 14:104177774-104177796 TGGCCTCGCTGTCGCGCCGCAGG - Exonic
1128322452 15:66703095-66703117 TGTCGTCGAAGGGGCGCCGCAGG - Exonic
1132893365 16:2215233-2215255 GGCTCTCGCAGGAGCGCCGCGGG + Intergenic
1133021045 16:2967112-2967134 CGCCATCGAAGGCGCGGAGCAGG - Exonic
1142859042 17:2749757-2749779 TCCCCCCGACCGCGCGCCGCCGG - Intergenic
1146054507 17:29574398-29574420 TGCCCTAGAAGGCGAGGGGCTGG + Exonic
1148440480 17:47709245-47709267 TGCCCTCGAAGGCGCGCCGCGGG - Exonic
1152571306 17:81122396-81122418 CGCCCCCGACGGCGCGCCCCCGG - Exonic
1157599452 18:48885234-48885256 TGTCCTCGAGGGAGCGCCTCGGG + Intergenic
1162738113 19:12757858-12757880 TGTCCCCGAAGGCGCGGCCCCGG + Exonic
1163480865 19:17555613-17555635 TCCCCTTTAAGGCGCGCGGCCGG + Exonic
1164868859 19:31626788-31626810 TGACCTGGAAGGAGCGCAGCTGG - Intergenic
1166790698 19:45396812-45396834 CGCCATCGAAGGCGCGGGGCCGG + Exonic
1175141210 20:56861452-56861474 TGCCCTGGATGGCACGCCCCGGG - Intergenic
1179882218 21:44297649-44297671 TGCCATCGAAGGTGTGCTGCGGG - Exonic
1181087220 22:20446649-20446671 TGCCCACGCAGGCGCGACGCTGG - Exonic
954223963 3:49171183-49171205 TGGCCTCCAGGGGGCGCCGCCGG + Intergenic
962198012 3:133380096-133380118 TGCCCTCGAGGGCGGCCCTCTGG - Exonic
992067376 5:73120429-73120451 TTCCCTCGCGGGCGCGCCCCGGG + Exonic
1014798080 6:125748480-125748502 TGCCCTCGCAGACGCACAGCGGG + Intronic
1019381557 7:726855-726877 GGGCCTCCAAGGCGCGCCGCCGG - Exonic
1054781957 9:69174072-69174094 GAGCCTCGAAGGCGCGGCGCCGG + Intronic
1195308370 X:103607890-103607912 TGCCCACGTAGGCGCCCGGCGGG - Intronic