ID: 1148441378

View in Genome Browser
Species Human (GRCh38)
Location 17:47713364-47713386
Sequence GGCGGAAAGTTGCTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148441370_1148441378 0 Left 1148441370 17:47713341-47713363 CCTGGGAGACGGCTCAGGTGCAG No data
Right 1148441378 17:47713364-47713386 GGCGGAAAGTTGCTGGGGGCTGG No data
1148441367_1148441378 16 Left 1148441367 17:47713325-47713347 CCTTGATTTCTAGGGGCCTGGGA No data
Right 1148441378 17:47713364-47713386 GGCGGAAAGTTGCTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148441378 Original CRISPR GGCGGAAAGTTGCTGGGGGC TGG Intergenic
No off target data available for this crispr