ID: 1148441724

View in Genome Browser
Species Human (GRCh38)
Location 17:47714994-47715016
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148441724_1148441731 12 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441731 17:47715029-47715051 CTCCAACACTCCCACGGTGCAGG No data
1148441724_1148441729 6 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441729 17:47715023-47715045 CCTTGCCTCCAACACTCCCACGG No data
1148441724_1148441735 19 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441735 17:47715036-47715058 ACTCCCACGGTGCAGGGGACAGG No data
1148441724_1148441737 22 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441737 17:47715039-47715061 CCCACGGTGCAGGGGACAGGAGG No data
1148441724_1148441732 13 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441732 17:47715030-47715052 TCCAACACTCCCACGGTGCAGGG No data
1148441724_1148441734 14 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441734 17:47715031-47715053 CCAACACTCCCACGGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148441724 Original CRISPR AACCTCAAAGTCCCCCTCAA GGG (reversed) Intergenic
No off target data available for this crispr