ID: 1148441729

View in Genome Browser
Species Human (GRCh38)
Location 17:47715023-47715045
Sequence CCTTGCCTCCAACACTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148441725_1148441729 5 Left 1148441725 17:47714995-47715017 CCTTGAGGGGGACTTTGAGGTTC No data
Right 1148441729 17:47715023-47715045 CCTTGCCTCCAACACTCCCACGG No data
1148441724_1148441729 6 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441729 17:47715023-47715045 CCTTGCCTCCAACACTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148441729 Original CRISPR CCTTGCCTCCAACACTCCCA CGG Intergenic
No off target data available for this crispr