ID: 1148441735

View in Genome Browser
Species Human (GRCh38)
Location 17:47715036-47715058
Sequence ACTCCCACGGTGCAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148441726_1148441735 -4 Left 1148441726 17:47715017-47715039 CCCTTTCCTTGCCTCCAACACTC No data
Right 1148441735 17:47715036-47715058 ACTCCCACGGTGCAGGGGACAGG No data
1148441724_1148441735 19 Left 1148441724 17:47714994-47715016 CCCTTGAGGGGGACTTTGAGGTT No data
Right 1148441735 17:47715036-47715058 ACTCCCACGGTGCAGGGGACAGG No data
1148441725_1148441735 18 Left 1148441725 17:47714995-47715017 CCTTGAGGGGGACTTTGAGGTTC No data
Right 1148441735 17:47715036-47715058 ACTCCCACGGTGCAGGGGACAGG No data
1148441727_1148441735 -5 Left 1148441727 17:47715018-47715040 CCTTTCCTTGCCTCCAACACTCC No data
Right 1148441735 17:47715036-47715058 ACTCCCACGGTGCAGGGGACAGG No data
1148441728_1148441735 -10 Left 1148441728 17:47715023-47715045 CCTTGCCTCCAACACTCCCACGG No data
Right 1148441735 17:47715036-47715058 ACTCCCACGGTGCAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148441735 Original CRISPR ACTCCCACGGTGCAGGGGAC AGG Intergenic
No off target data available for this crispr