ID: 1148446235

View in Genome Browser
Species Human (GRCh38)
Location 17:47739287-47739309
Sequence ATGGAGACACAGGAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 1, 2: 5, 3: 90, 4: 917}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148446235_1148446242 12 Left 1148446235 17:47739287-47739309 CCAGCCTCTTCCTGTGTCTCCAT 0: 1
1: 1
2: 5
3: 90
4: 917
Right 1148446242 17:47739322-47739344 GTGATAAAAACAGGATGAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 215
1148446235_1148446245 21 Left 1148446235 17:47739287-47739309 CCAGCCTCTTCCTGTGTCTCCAT 0: 1
1: 1
2: 5
3: 90
4: 917
Right 1148446245 17:47739331-47739353 ACAGGATGAGCTGGGCATGGTGG 0: 1
1: 5
2: 147
3: 4352
4: 28395
1148446235_1148446241 3 Left 1148446235 17:47739287-47739309 CCAGCCTCTTCCTGTGTCTCCAT 0: 1
1: 1
2: 5
3: 90
4: 917
Right 1148446241 17:47739313-47739335 CCTCTACTAGTGATAAAAACAGG 0: 1
1: 0
2: 1
3: 8
4: 111
1148446235_1148446243 13 Left 1148446235 17:47739287-47739309 CCAGCCTCTTCCTGTGTCTCCAT 0: 1
1: 1
2: 5
3: 90
4: 917
Right 1148446243 17:47739323-47739345 TGATAAAAACAGGATGAGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 314
1148446235_1148446244 18 Left 1148446235 17:47739287-47739309 CCAGCCTCTTCCTGTGTCTCCAT 0: 1
1: 1
2: 5
3: 90
4: 917
Right 1148446244 17:47739328-47739350 AAAACAGGATGAGCTGGGCATGG 0: 1
1: 0
2: 32
3: 511
4: 8470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148446235 Original CRISPR ATGGAGACACAGGAAGAGGC TGG (reversed) Intronic
900086349 1:899614-899636 TTGGAGACCCAGGACGAGCCTGG + Intergenic
900302937 1:1986943-1986965 ATCGCCACAGAGGAAGAGGCGGG - Exonic
900317150 1:2062892-2062914 ATGGAGACAGAGGCTGAGTCTGG - Intronic
900426309 1:2581097-2581119 ATGTAAACACGAGAAGAGGCAGG + Intergenic
900457913 1:2786284-2786306 ATGGACACACAGCCAGGGGCTGG - Intronic
900680125 1:3911992-3912014 CTGGAGACAAAGGAAGAGAAAGG - Intergenic
900720060 1:4170143-4170165 ATGCAGGCACTGGAAGAGACTGG + Intergenic
900740040 1:4325472-4325494 ATTGAGACCCAGGCAGATGCTGG - Intergenic
900745645 1:4359026-4359048 GTGAAGACAGAGGCAGAGGCTGG + Intergenic
901844066 1:11971138-11971160 GTGGAGAGACTGGAAGGGGCAGG + Intronic
902040091 1:13486208-13486230 ATGGAGACAGAGGGAGAGGCTGG - Intronic
902073414 1:13762450-13762472 TTGGAGACACAGGAACCTGCTGG + Intronic
902502726 1:16921781-16921803 AGGGAGCCAAAGGAAGAGGAAGG - Intronic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903288362 1:22291237-22291259 ATGGAGAGACAGGAACAGAGAGG - Intergenic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903354301 1:22736836-22736858 ATGGAGACACAGGACTCAGCCGG + Intronic
903594251 1:24482121-24482143 ATAGAGAGACAGGAAAAGGTGGG - Intergenic
903745127 1:25581686-25581708 ATGGAGACCCCGGGAGGGGCAGG + Intergenic
904794049 1:33045439-33045461 AGGGAGAGAGAGGAAGGGGCAGG + Intronic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905198685 1:36301557-36301579 TTCGAGCCAGAGGAAGAGGCTGG + Exonic
905546659 1:38805125-38805147 ATGGATTCAAAGGAGGAGGCTGG + Intergenic
905856675 1:41319156-41319178 ATGAAGACAAAGGCAGAAGCAGG - Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906577488 1:46903971-46903993 ACTGAGACAGAAGAAGAGGCTGG - Intergenic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
907871040 1:58443115-58443137 AAGGAGGAACAGGAAGTGGCAGG - Intronic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
908403375 1:63791231-63791253 ATGGTGACACAGTGAGAGTCTGG + Intronic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908988810 1:70059279-70059301 ATGGACACAGAGGAAGAGGAAGG + Intronic
910032490 1:82745732-82745754 AGGGAGAGAAAGGAAGAGGAGGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910991235 1:93058730-93058752 ATGGAGGTAAAGGAGGAGGCTGG + Intergenic
911367332 1:96954374-96954396 GTGAAGACAAAGGCAGAGGCTGG - Intergenic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
911719893 1:101179320-101179342 AAGGAGACAAAGGAAGAAGTAGG + Intergenic
912426701 1:109599426-109599448 ATAGAGACAAAGGAAAATGCTGG - Exonic
912693292 1:111820844-111820866 GTGAAGACAGAGGCAGAGGCTGG + Intronic
913070577 1:115294824-115294846 CTGGAGAGCCAGGAAGAGCCAGG + Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913680649 1:121185486-121185508 TGGGAGACACTGGAGGAGGCCGG - Intronic
914032481 1:143973128-143973150 TGGGAGACACTGGAGGAGGCCGG - Intergenic
914156965 1:145094839-145094861 TGGGAGACACTGGAGGAGGCCGG + Intronic
914857716 1:151364657-151364679 ATGTAGACACAGTAAAAGGAGGG - Exonic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916845935 1:168650061-168650083 ATGGAGTCTGAGGAACAGGCAGG - Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
916971657 1:170026069-170026091 ATGAAGACAAAGGCAGAGACTGG + Intronic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917147943 1:171912597-171912619 AGGGAGACAAAAGAAGAGGAAGG + Intronic
917639463 1:176969000-176969022 ATGGCCATACAGGAAAAGGCGGG + Intronic
918417675 1:184328987-184329009 ATGGACACAGAGGAAGTGGAGGG - Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918743339 1:188165498-188165520 ATGAAGACACAGCAAGAAGGTGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919739943 1:200975336-200975358 ATGGAGACAGAGGAGGAAGAGGG + Intronic
919779074 1:201211185-201211207 ATGGAGTCAATGGATGAGGCAGG + Exonic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
919934269 1:202241357-202241379 ATGGGGGCACAGTAAGAGGTAGG + Intronic
920164598 1:204026600-204026622 CTGGAGACAAAGGCAGAGGGAGG + Intergenic
920267728 1:204736877-204736899 CTCTAGGCACAGGAAGAGGCAGG + Intergenic
920467961 1:206204012-206204034 TGGGAGACACTGGAGGAGGCCGG - Intronic
922133544 1:222802640-222802662 AGGAATACACAGGAAGAGGAAGG + Intergenic
922533804 1:226364946-226364968 ATGGAGACACCTGCAGAGACAGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923773260 1:236956397-236956419 ATGGAGAGAAAGGAAGAAACAGG - Intergenic
923865823 1:237938558-237938580 TTGGGGTCACAGGAAGAGGGAGG - Intergenic
924278676 1:242413721-242413743 ATGGAAAGGTAGGAAGAGGCAGG + Intronic
1063046668 10:2399248-2399270 ATGGAGTCGGAGGAAGAGCCTGG - Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064854083 10:19745676-19745698 AGAGAGAGACAGGCAGAGGCAGG - Intronic
1066789332 10:39045516-39045538 ACAGAGACAAAAGAAGAGGCTGG - Intergenic
1067556395 10:47276301-47276323 ATCCAGAGAGAGGAAGAGGCTGG - Intergenic
1067764619 10:49075645-49075667 ATAGAGACACAGGCAGAGGCTGG + Intronic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1068251094 10:54441819-54441841 ATTGAGAGACAGGGAAAGGCCGG + Intronic
1068644554 10:59451223-59451245 ATGGCTATAGAGGAAGAGGCAGG - Intergenic
1069277893 10:66615460-66615482 AAGGAGACACAGGAAGGAGAAGG + Intronic
1069627958 10:69880105-69880127 AGGGAGACACAGGGAGAGAGGGG - Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070740824 10:78902147-78902169 TGGGAGACCTAGGAAGAGGCAGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071003656 10:80858939-80858961 AGGGCGACAGAGGCAGAGGCTGG + Intergenic
1073354328 10:102841782-102841804 ACTGAGACAGAAGAAGAGGCTGG + Intergenic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1073810510 10:107147532-107147554 AATGAGACACAGGAAGAGAGAGG - Intronic
1074122792 10:110505638-110505660 ATGGAAACACAGGAAGCAGATGG + Intronic
1074214123 10:111367530-111367552 ATGGAGGCACAGCACAAGGCAGG + Intergenic
1074313602 10:112343044-112343066 AAAGAGACATAGGAAGAGGAGGG - Intergenic
1075180436 10:120206153-120206175 AGAGAGACACGGGAAGGGGCAGG - Intergenic
1075973525 10:126674688-126674710 ATGGGGACACAGTGAGAGGGTGG + Intergenic
1076075104 10:127527501-127527523 AGGCAGACAGAGGAAGAGGAAGG - Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076121446 10:127939988-127940010 AGGAATAGACAGGAAGAGGCAGG + Intronic
1076328137 10:129644441-129644463 AAGAGGACACAGCAAGAGGCTGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076407421 10:130221927-130221949 ATGGAGACACACCCAGAGGCCGG - Intergenic
1076856323 10:133117069-133117091 ATGGAGGCACAGGCAGAAGGGGG + Intronic
1077025740 11:439115-439137 GTGCAGACACAGGAAGAAGGTGG + Intronic
1077088333 11:765830-765852 ATTGAAAAACAGGGAGAGGCCGG - Intergenic
1077159352 11:1105650-1105672 GTGGACACCCAGGAGGAGGCAGG - Intergenic
1077223288 11:1426771-1426793 GTGCAGACACAGGATGTGGCGGG + Intronic
1077392806 11:2307817-2307839 ATGGAGACCCAGGCAGAGTATGG + Intronic
1077452018 11:2654104-2654126 GTGGAGACACAGGTGGTGGCGGG + Intronic
1077775926 11:5271475-5271497 ATGGAGACGGAGGCAGAGGTGGG - Intronic
1077792979 11:5461434-5461456 GTGGAGACCCTGGGAGAGGCTGG + Intronic
1077980629 11:7296571-7296593 AAAGAGACACAGGAAGAAGAAGG - Intronic
1078019246 11:7641476-7641498 CAGGAGACACAGAAAGTGGCTGG + Exonic
1078102828 11:8339814-8339836 AAGGAGACCCGGGAAGAGGTTGG - Intergenic
1078406777 11:11077041-11077063 AAAGAGGCACAGGATGAGGCTGG - Intergenic
1078501283 11:11880531-11880553 ATGGAGGCAAAGGAAGAAGAAGG - Intronic
1078799306 11:14627024-14627046 ATGAAGACACAGCAAGAAGGGGG - Intronic
1079089672 11:17471765-17471787 ATGGAAAGATGGGAAGAGGCTGG + Intronic
1079090117 11:17475032-17475054 AGGGAGAGACAGTCAGAGGCAGG + Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1079563572 11:21852545-21852567 ATGGACACAAAGGGAGAGGTTGG - Intergenic
1079906379 11:26253031-26253053 ATGGAGACAGAGGAAGCAGAGGG + Intergenic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1082773998 11:57231922-57231944 ATAGAGACAGAGGCAGAGGGAGG - Intergenic
1083225167 11:61280571-61280593 GTGCAGAGAAAGGAAGAGGCAGG + Intronic
1083386629 11:62315573-62315595 ATGGTGACACAGCAAGGGTCTGG - Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083590051 11:63888526-63888548 AGGGAGACAGAGAAAGAGGCGGG - Intronic
1083737374 11:64689207-64689229 AGGGAGACACAGAGAGAGGCAGG - Intronic
1083967420 11:66051352-66051374 TTGGAGACAGAGGCAGAGACTGG - Intronic
1084401641 11:68947308-68947330 CTGCAAACACAGGCAGAGGCTGG + Intergenic
1084413005 11:69014817-69014839 ATGGGGACTCAGTGAGAGGCTGG - Intergenic
1084421398 11:69062447-69062469 ATGGGGACACAAGGGGAGGCGGG + Intronic
1084423873 11:69073789-69073811 GTGAGGACACAGGGAGAGGCTGG - Intronic
1084423883 11:69073841-69073863 GTGAGGACACAGGGAGAGGCTGG - Intronic
1084453167 11:69251974-69251996 TTGGAAGCACATGAAGAGGCCGG - Intergenic
1084536786 11:69762071-69762093 TTGGGGACACAGGGAGAAGCTGG + Intergenic
1084581990 11:70029844-70029866 GTGAAGACCGAGGAAGAGGCTGG - Intergenic
1084603800 11:70161415-70161437 AAGGATGCACAGCAAGAGGCAGG - Intronic
1084659624 11:70539158-70539180 ATGCACACAGAGGGAGAGGCCGG + Intronic
1084683081 11:70678470-70678492 AGGGAGAGGCAGGGAGAGGCAGG - Intronic
1084776790 11:71382320-71382342 ACTGATACACAGGAAGAGCCAGG + Intergenic
1084938859 11:72601663-72601685 CAGGAGACACAAGAAGAGGAAGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1084965361 11:72741646-72741668 AGGCAGAAACAGGAAGAGACAGG + Intronic
1085049218 11:73371372-73371394 ATGGGGAAAGAGGAAAAGGCAGG + Intergenic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1086476084 11:87176267-87176289 ATGGGGAGACAGGAAGGGGCAGG - Intronic
1087749304 11:101989661-101989683 AAGGAAACACAGAAACAGGCCGG + Intronic
1087990508 11:104742214-104742236 GTGGAAACACAGGAAAAGGTTGG + Intergenic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088260011 11:107935025-107935047 ATGGAGAGGCAGGCAAAGGCCGG - Intronic
1088502611 11:110497730-110497752 TTGGAGCAACAGGAAGAGACAGG + Intergenic
1090262853 11:125334035-125334057 AGGAAGACATAGGAGGAGGCTGG + Intronic
1090593273 11:128294176-128294198 ATGAAGACAGAGCAAGGGGCAGG - Intergenic
1090751611 11:129750841-129750863 CTGGAGGCACAGGGAGCGGCTGG + Intergenic
1091263500 11:134252858-134252880 GTCGAGACCCCGGAAGAGGCTGG - Exonic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091405263 12:204733-204755 ATGGAGGCTGAGGAAGAGCCCGG - Intronic
1092033003 12:5305526-5305548 CTGGGGACAAAGGGAGAGGCAGG - Intergenic
1092597967 12:10028151-10028173 TTGGAGGCAGAGGAAAAGGCAGG - Intergenic
1093201708 12:16195230-16195252 ATAGAGACAGAGGCAGAGGCAGG - Intronic
1093282350 12:17210057-17210079 ATGAAGATACAGGGAGAAGCTGG - Intergenic
1094080847 12:26533695-26533717 ATGAAGACACAAGGAGAGGGTGG + Intronic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095396347 12:41766475-41766497 AGGAAGACACAGGAAGGGGAAGG - Intergenic
1096120876 12:49088889-49088911 AGGGGGGCACAGTAAGAGGCTGG - Intergenic
1096474394 12:51899288-51899310 CCCGAGACTCAGGAAGAGGCTGG - Intergenic
1096490001 12:52007934-52007956 CTGGGGCCAGAGGAAGAGGCTGG - Intronic
1096528840 12:52231030-52231052 ATGGAGAGGCAGGAGGAGACTGG + Intergenic
1096893384 12:54794834-54794856 GTGAAGACACAGGAAGAAGGTGG + Intergenic
1097078690 12:56413532-56413554 AGGGAGAGCCAGGAACAGGCAGG - Intergenic
1097264841 12:57738792-57738814 ATGGAGATACAGGAGGCGGCGGG + Intronic
1098039172 12:66336759-66336781 CTGCAGACACAGGAACTGGCAGG + Intronic
1098079180 12:66765859-66765881 ATGGGGAGACAGGAAGAAGATGG + Intronic
1098191672 12:67955674-67955696 ATGGATATAAAGGAAGAGGAAGG - Intergenic
1099390378 12:82071801-82071823 ATGAAGACACAAGGAGAGGTAGG + Intergenic
1099710247 12:86214595-86214617 GTGAGGACACAGCAAGAGGCTGG - Intronic
1099947213 12:89258367-89258389 ATGAAGACACAGGAAGAAAATGG + Intergenic
1100006971 12:89906238-89906260 ATGGAGAGACTGGGAAAGGCAGG - Intergenic
1100247175 12:92770558-92770580 ATGGATACAGAGTAAGATGCTGG - Exonic
1100270345 12:93018734-93018756 ATGAAGATACAGGAAAAGGTAGG - Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101258318 12:103002472-103002494 AGAGAGACACAGGAAGAGCTTGG - Intergenic
1101288425 12:103340815-103340837 CTGAAGACACAGCAATAGGCTGG + Intronic
1101423371 12:104567462-104567484 AAGGAAATAAAGGAAGAGGCAGG - Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101855423 12:108438612-108438634 ATGGATGCACAGAAAAAGGCTGG + Intergenic
1101898734 12:108775231-108775253 ATGGACACACATGAAGAGTTTGG + Intergenic
1102186544 12:110951900-110951922 AGGGAGACAGAGGGAGAGGGAGG + Intergenic
1102310060 12:111837695-111837717 GTGAAGACAGAGGAAGAGCCTGG + Intergenic
1102986060 12:117279669-117279691 ATGGAGCGAGAGGAAGAGGTTGG + Intronic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103627108 12:122227589-122227611 GTGGCGACACAGGCAGAGGGCGG - Intronic
1104300556 12:127560907-127560929 GTGTAAACACAGGGAGAGGCAGG + Intergenic
1104674022 12:130700561-130700583 GTGGAGACAGAGGCAGAGGTGGG + Intronic
1104887489 12:132119169-132119191 ATGGTGCCGCAGGCAGAGGCTGG - Intronic
1105443926 13:20436563-20436585 CTGAAGGCCCAGGAAGAGGCTGG - Intronic
1105520019 13:21123375-21123397 AGGGAGACAGAGGGAGAGCCAGG - Intergenic
1106082367 13:26511055-26511077 GTGAAAACACAGGGAGAGGCTGG + Intergenic
1107275646 13:38675926-38675948 ATGGATATAAAGGAAGAGGAAGG + Intergenic
1107386409 13:39914496-39914518 ATGAAGACAGAGGAAGAGATTGG + Intergenic
1107658122 13:42612633-42612655 GTGAAGACAGAGGCAGAGGCTGG - Intergenic
1108415294 13:50192311-50192333 ATGGAAATGCAGGAAGAGCCTGG - Intronic
1108981030 13:56514744-56514766 AAGGAGACACTGGAAAAGCCAGG - Intergenic
1109184750 13:59254573-59254595 AAGAAAACACAGAAAGAGGCAGG + Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110815393 13:79855130-79855152 ATGAAGACACCGGAAGAGTAAGG - Intergenic
1111257417 13:85689336-85689358 AGGGAGACAATGGAAGAGGGAGG + Intergenic
1111664057 13:91245177-91245199 AAGCAGACACAGGGAGAGGGAGG - Intergenic
1111999030 13:95193132-95193154 ATGTAGAGAAAGGAAGAGTCTGG + Intronic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112444933 13:99455433-99455455 ATGGAGATAGATGAAGAGGCAGG - Intergenic
1112574983 13:100627519-100627541 ATGAAGACAGAGGCAGAGGTGGG - Intronic
1112740997 13:102472512-102472534 CTGCAGACCCAGGAAAAGGCAGG - Intergenic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1114555703 14:23561184-23561206 GGGGACACACAGGAAGAAGCAGG + Intronic
1114690075 14:24573343-24573365 ATGTGGACACAGGGAGAGGATGG + Intergenic
1115196776 14:30809304-30809326 ATGAAGACTCTGCAAGAGGCTGG + Intergenic
1115364053 14:32536310-32536332 AAGGAGAGACAGGAATAGACTGG + Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1115972550 14:38962118-38962140 ATGAAGACACAGTGAGAAGCTGG - Intergenic
1116674367 14:47886815-47886837 AGGGAGACAAAGGAAGAGGAAGG + Intergenic
1117158457 14:52964012-52964034 ATAGAGCCACAAGAAGAGGCAGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117964268 14:61190653-61190675 GTGGAAACACAGCAAGAGGCAGG - Intronic
1118032105 14:61828095-61828117 GTGAAGACACAGGAAGAAGATGG + Intergenic
1118127660 14:62926643-62926665 ATGAAGACACAGTGAGAAGCTGG - Intronic
1118164382 14:63321634-63321656 ATGGAGACACTGACAGAGCCTGG + Intergenic
1118502319 14:66373362-66373384 ATGAATACATAGAAAGAGGCAGG - Intergenic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1119443857 14:74647746-74647768 ATGAAGACAGAGGGAGAGGGAGG - Intergenic
1120030096 14:79631447-79631469 GTGGAGAGACAGGCAGAGGTGGG + Intronic
1120421570 14:84292624-84292646 ATGAAGACACAGGCAGAGACTGG - Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120852564 14:89184660-89184682 ATGGAGACCCAGGAAGGTGAAGG - Intronic
1120876929 14:89383631-89383653 AAGATGACACAGGAAGAGACTGG - Intronic
1120998544 14:90435106-90435128 AGGGAGACACAGCAAGAGTCTGG - Intergenic
1121080412 14:91103397-91103419 ATGGAGACGGAGGAGGAGGGAGG - Intronic
1121114696 14:91335456-91335478 AGGGAGAGCCAGGCAGAGGCAGG - Intronic
1121339170 14:93094741-93094763 CTGCAGGCACAGGGAGAGGCAGG + Intronic
1121426156 14:93853623-93853645 ATGAAGACACAGGGAGAAGGCGG + Intergenic
1121819108 14:96951521-96951543 AGGGAGGCACGGGAGGAGGCTGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121883651 14:97523199-97523221 ATGAAGACACAGGGAGAAGGTGG - Intergenic
1122150573 14:99724039-99724061 GTGGAGACACAGGGAGAAGGTGG - Intronic
1122385382 14:101341799-101341821 GGGGAGACACGGGATGAGGCTGG - Intergenic
1122424134 14:101595935-101595957 ATGGATCAACAGGAAAAGGCAGG + Intergenic
1122432729 14:101666203-101666225 GTGCAGACACAGCAAGAAGCTGG - Intergenic
1122697129 14:103561656-103561678 ATGGAGAGAAACGAAGAAGCGGG - Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123102226 14:105811944-105811966 ATGAAGACAGAGGCAGAGGCTGG + Intergenic
1123123262 14:105927824-105927846 ATGGAGAGACTGGAGGAGGCAGG - Intronic
1123400854 15:19984275-19984297 CAGGAGCCACAGGAAGTGGCGGG - Intergenic
1123405912 15:20019328-20019350 ATGCAGAGACTAGAAGAGGCAGG - Intergenic
1123515242 15:21025976-21025998 ATGCAGAGACTAGAAGAGGCAGG - Intergenic
1123890670 15:24775307-24775329 ATGGGGAGACAAGAAGAGTCAGG + Intergenic
1124043797 15:26128968-26128990 ACGGACACAAAGGCAGAGGCTGG + Intergenic
1124411413 15:29440706-29440728 ATGGTGACAGTGGAAGAGGCAGG - Intronic
1125385311 15:39130676-39130698 ATGAAGAAACAGGAAGCAGCTGG + Intergenic
1125533694 15:40430254-40430276 ATGGAGAAACAGGAGGACCCAGG + Intronic
1125697844 15:41653839-41653861 ATGGTGGCAAAGGAAGAGGCAGG - Intronic
1125787830 15:42337763-42337785 AAGAAGATACATGAAGAGGCTGG + Intronic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1126096757 15:45095655-45095677 ACGGAGACACAGGCAGAGGGAGG + Intronic
1126131802 15:45348903-45348925 AGGAAGACTCAGGGAGAGGCAGG + Intergenic
1126179619 15:45772348-45772370 ATGGAGACACACACAGAGGTGGG - Intergenic
1126196397 15:45936649-45936671 ATGGAGAAATAGTAGGAGGCAGG - Intergenic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1127366106 15:58292178-58292200 ATGAAGACACAGGAATAAGATGG - Intronic
1127462580 15:59212857-59212879 GTGAAGACACAGGCAGAGACTGG + Intronic
1127715564 15:61645833-61645855 ATGAAGACAGAGGCAGAGACTGG + Intergenic
1128063090 15:64747550-64747572 AGGCAGCCACAGGAAGGGGCTGG - Intronic
1128147284 15:65338785-65338807 ATGAAGACAGATGAGGAGGCAGG - Intronic
1128222092 15:65976517-65976539 ATAGAGACACAGGGAGAAGATGG + Intronic
1128313017 15:66643495-66643517 GTAGAGACACAGGAAGAAGATGG + Intronic
1128555453 15:68628768-68628790 ATGTAGACTCCGGAGGAGGCAGG - Intronic
1128656743 15:69468249-69468271 AAGGAGGCTCAGGAAGCGGCCGG - Intergenic
1128787002 15:70405022-70405044 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1129689992 15:77707733-77707755 GGGCAGACTCAGGAAGAGGCTGG + Intronic
1129816751 15:78561965-78561987 AAGGAGACCCAGTGAGAGGCTGG + Intergenic
1129822631 15:78615335-78615357 TTGGGGACACAGGCAGAGACAGG + Intronic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1130567476 15:85008864-85008886 CTCGAGACACAGGGAGAGGGAGG - Intronic
1130983111 15:88826476-88826498 CTGGAGACACAGGGAAAGCCAGG + Intronic
1130991232 15:88877268-88877290 ATGGAGACACAGAAAAGGGCTGG + Exonic
1131205529 15:90442620-90442642 CTGGTGACATAGGCAGAGGCAGG - Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131438631 15:92442236-92442258 GCAGAGACACAAGAAGAGGCAGG - Intronic
1131541780 15:93280602-93280624 GAGGAGACCCAGGCAGAGGCAGG - Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131778591 15:95829231-95829253 ATGGCGGCTCAGGAAGAGGGAGG - Intergenic
1132155104 15:99490420-99490442 ATTAAGACATATGAAGAGGCAGG - Intergenic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132392141 15:101446999-101447021 AAGGTGACACAGCAGGAGGCAGG + Intronic
1132851190 16:2025744-2025766 TTGGAGACAGAGGAAGAGCTGGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133246907 16:4455149-4455171 AAGAAGACACAGCCAGAGGCTGG - Intronic
1133418666 16:5626314-5626336 ATGAAGACACAGGGAGAAGACGG - Intergenic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1133976828 16:10605213-10605235 ATAGAAATACAGTAAGAGGCCGG + Intergenic
1134091095 16:11392105-11392127 GTGAGGACAGAGGAAGAGGCTGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135489657 16:22898497-22898519 ATTGAGCCACAGGAAGAGCCAGG + Intronic
1136028237 16:27483878-27483900 GTGGAGGCAGAGGCAGAGGCTGG - Intronic
1136293488 16:29289487-29289509 AAGGAGACAGAGGGAGGGGCAGG + Intergenic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136990579 16:35149025-35149047 AAGGATACACAGGAAGACCCTGG - Intergenic
1137248035 16:46721333-46721355 ATGGAAATACATGAAGGGGCTGG + Intronic
1137582439 16:49641452-49641474 AGAGAGACACAGGAACTGGCTGG + Intronic
1137832912 16:51561535-51561557 ATGGAGAGAGAGGAAGAGAGAGG + Intergenic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138564246 16:57821234-57821256 ATGCAGACCCAGGTAGAAGCTGG + Intronic
1138583095 16:57954300-57954322 ATGTAAACAAATGAAGAGGCAGG + Intronic
1139254345 16:65527069-65527091 ATGCAGACAGAGGCAGAGACTGG + Intergenic
1139421456 16:66851759-66851781 ATGGGGAGAGAGGAAGAGGCTGG + Intronic
1140887137 16:79254250-79254272 ATGTAGAGAGAGAAAGAGGCAGG - Intergenic
1141048468 16:80738605-80738627 GTGGGGACACAAGAATAGGCGGG + Intronic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141754319 16:85981268-85981290 AGAGAGACACTGGAAGATGCTGG + Intergenic
1141788709 16:86218530-86218552 GTGGAGACAGAGGCAGAGGTTGG + Intergenic
1141856093 16:86682451-86682473 GGGGAGACAGAGGCAGAGGCTGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142099368 16:88263493-88263515 AAGGAGACAGAGGGAGGGGCAGG + Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142697088 17:1639745-1639767 ATGGAGTGACATGGAGAGGCAGG + Intronic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143103078 17:4514682-4514704 AGGGAGACCCAGGAAGGGGTAGG - Intronic
1143287875 17:5804520-5804542 GTGGAGACAAAGGCAGAGGTTGG - Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143974192 17:10818102-10818124 ATGGACACACAGGGAGAAGACGG + Intergenic
1144062350 17:11594626-11594648 ATGGACACACAGGAGGAGTCAGG - Intergenic
1144336704 17:14277955-14277977 AGGAAGACACATGAGGAGGCAGG + Intergenic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1144745661 17:17612490-17612512 ATGGAAACAAAGGATGAGCCTGG + Intergenic
1144784730 17:17825262-17825284 ATAAAGACACAATAAGAGGCAGG - Intronic
1145007943 17:19348063-19348085 GTGGAGACACAGGAAGTACCAGG - Intronic
1145018091 17:19411810-19411832 AGGGAGGGACAGGAAGAAGCAGG + Intronic
1145145584 17:20476890-20476912 AGGGAGAAACAGGAAGCCGCAGG + Intergenic
1145369941 17:22299782-22299804 AGGGAGACAGAGTAAGAGGGAGG - Intergenic
1146315038 17:31800166-31800188 ATGAAGACAGAGGAAGAAGATGG - Intergenic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146749283 17:35363174-35363196 ACTGAGACTCAGGAAAAGGCAGG + Exonic
1146757375 17:35445050-35445072 ATGGAGACTCAGGAAAAGATAGG + Exonic
1147382608 17:40064138-40064160 ATGGGGACAAGGGAAGAGACAGG + Intronic
1148330851 17:46813126-46813148 ATGGAGCCACAGAAAGAAACGGG + Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148767805 17:50049423-50049445 GTGGAGAAACAGCAAAAGGCTGG + Intergenic
1148815928 17:50328185-50328207 GTGGAGCCACATTAAGAGGCAGG + Intergenic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149354756 17:55828365-55828387 AGGCAGAAACTGGAAGAGGCAGG - Intronic
1149370133 17:55985770-55985792 ATGGTGAGCCAGGGAGAGGCTGG - Intergenic
1149485801 17:57041969-57041991 ACTGAGACACAGGAAGGGTCTGG + Intergenic
1149516653 17:57286047-57286069 AGGGAAAGACAGAAAGAGGCTGG - Intronic
1149946631 17:60934860-60934882 ATGTAAAAACAGTAAGAGGCTGG + Intronic
1150004118 17:61459119-61459141 AGGAAGACACATGAAGGGGCTGG + Intronic
1150328375 17:64274809-64274831 ATGTGCACACAGGCAGAGGCAGG - Intergenic
1151219984 17:72605227-72605249 AAAAAGACACAGGGAGAGGCCGG + Intergenic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151410575 17:73924816-73924838 ATGAAGACACAGCAAGAGGTCGG + Intergenic
1151543380 17:74776678-74776700 AGGGAGAGAGAGGGAGAGGCTGG + Intronic
1151732072 17:75917593-75917615 ATGTAGAGGCAGGAAGCGGCAGG + Intronic
1151871644 17:76840792-76840814 AAGGAGAGAGAGGAAGAGACAGG - Intergenic
1152004672 17:77672618-77672640 GTGAAGACACAGGCAGAGGGTGG + Intergenic
1152048125 17:77952315-77952337 ATGGAGACAGCTGCAGAGGCAGG - Intergenic
1152193887 17:78904806-78904828 AAAGAGACAGAGGCAGAGGCAGG + Intronic
1152228009 17:79101659-79101681 AAGGAGAGAGAGGAAGAGGGAGG + Intronic
1152587234 17:81194508-81194530 AGTGAGCCACAGGAGGAGGCAGG - Intronic
1153173083 18:2338868-2338890 AGGAAGCAACAGGAAGAGGCAGG + Intergenic
1153274862 18:3358445-3358467 ATGGAGAGACAGCAAAAGACCGG - Intergenic
1153296382 18:3550640-3550662 ATGAAGACACAGGGAGAAGATGG + Intronic
1153512804 18:5873834-5873856 ATGAAGACACAGGGAGAAGATGG + Intergenic
1153700089 18:7683979-7684001 AGGGAGCCACAGGAAAAGGCAGG - Intronic
1153718450 18:7875708-7875730 ATAGAGAGAAAGGAAGAGGCAGG - Intronic
1154026912 18:10716551-10716573 AAGGAGGCACAGGAAGAGAACGG + Intronic
1154151867 18:11912590-11912612 CCGGAGCCAGAGGAAGAGGCAGG + Intergenic
1154468286 18:14670963-14670985 ATGAAGACACAGGAATATGGAGG - Intergenic
1155087242 18:22470614-22470636 ATGGAGGCACAGAAAAGGGCCGG + Intergenic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1155682217 18:28502229-28502251 AAGGAGACACAGGAATAGGGTGG + Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1155919017 18:31584455-31584477 ATGGAGACAATGGAACAAGCAGG - Intergenic
1155961549 18:31999662-31999684 AAGAAAAGACAGGAAGAGGCCGG - Intergenic
1156160832 18:34356208-34356230 ATGGAGATGCAGGCAGAGACGGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156508279 18:37613051-37613073 AAGGAGACCCAGGAGCAGGCTGG - Intergenic
1156773907 18:40764215-40764237 ATGGAGACAAAGTTAGAAGCTGG + Intergenic
1157367716 18:47081103-47081125 ATGGATAGAGAGGAAGAGGGAGG - Intronic
1157518788 18:48330504-48330526 ATGGAAACATTGGAAAAGGCTGG - Intronic
1157519072 18:48332755-48332777 ATGGAGTCACTGGTAGGGGCTGG - Intronic
1157803996 18:50644531-50644553 TTGGAGAGAAAGGAAGAGGGAGG - Intronic
1158704880 18:59783387-59783409 GGGGAGGGACAGGAAGAGGCAGG + Intergenic
1158770619 18:60512782-60512804 AAGTAGACCCAGGAGGAGGCTGG - Intergenic
1159072118 18:63636865-63636887 ATGGAGAGAAAGAAAGAGCCTGG - Intergenic
1159959538 18:74544948-74544970 AGAGAGACACAGAAAGAGGCTGG + Intronic
1160076146 18:75679577-75679599 GTGAAGACAGAGGCAGAGGCTGG - Intergenic
1160241803 18:77130335-77130357 AAGGGCACACAAGAAGAGGCGGG - Intronic
1160286604 18:77549022-77549044 AGTGAGACACAGGCAGAGACTGG - Intergenic
1160286661 18:77549379-77549401 AGTGAGACACAGGCAGAGACTGG - Intergenic
1160286677 18:77549481-77549503 AGTGAGACACAGGCAGAGACTGG - Intergenic
1160435107 18:78845596-78845618 ATAGAGACAGACAAAGAGGCAGG - Intergenic
1160537838 18:79604406-79604428 CTGGGGACACTGGAAGACGCAGG - Intergenic
1160735748 19:661680-661702 GTAGAGACCCAGGAAGGGGCTGG - Intronic
1160795510 19:943628-943650 GTGGAGACAGAGGCAGAGGCTGG + Intronic
1160799026 19:959143-959165 ACGAAGACAGAGGCAGAGGCTGG + Intronic
1160953928 19:1681024-1681046 ATGGAGAGACAGGGAGAGACAGG + Intergenic
1161119059 19:2515174-2515196 GAGGAGACATAAGAAGAGGCTGG + Intronic
1161128792 19:2575957-2575979 ATGCAGACACAGGCACATGCAGG + Intronic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161373110 19:3924679-3924701 ATTGGGACTCAGGATGAGGCAGG - Exonic
1161811565 19:6474309-6474331 GTGGAGACAGAGGAAGTGGGTGG + Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163721582 19:18900450-18900472 CTGGAGACACAGGCAGACACGGG + Intronic
1163807898 19:19411122-19411144 ATGGAGAGAGGGGAATAGGCTGG - Intronic
1164365962 19:27581944-27581966 ACGGAGACAGAAGAAGAGGCTGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164840799 19:31390730-31390752 ATGAATACACAGGCAGAGACTGG - Intergenic
1164884964 19:31770621-31770643 AGGGATACACAGGAAGATCCTGG + Intergenic
1165107121 19:33477080-33477102 TTGGAGAGACAGGCAGTGGCTGG - Intronic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165831475 19:38732741-38732763 ATGGAGCCACAGGGAGATGGGGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166347973 19:42178123-42178145 ATAGAGACACAGGAACAGAGTGG + Intronic
1166376629 19:42331091-42331113 CTGGTGAGACAGGATGAGGCCGG + Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166715193 19:44962505-44962527 ATGAAGACACAGGGAGAAGACGG - Intronic
1166786239 19:45369023-45369045 AGGCAGACAAAGGAAGGGGCGGG - Intronic
1167455074 19:49593551-49593573 GAGGAGACACAGCAAGGGGCGGG - Intronic
1167609308 19:50499239-50499261 AGGGAGACAGAGGGAGAGACAGG + Intergenic
1167609319 19:50499317-50499339 AGGGAGACAGAGGGAGAGACAGG + Intergenic
1167686586 19:50960323-50960345 ACGGAGACACAGGCAGAAACAGG - Intronic
1167719508 19:51168716-51168738 ATGGTGAGTCAGGATGAGGCAGG - Intergenic
1168084190 19:54033319-54033341 GTGGAGACACAGCAAGAAGGCGG - Intergenic
1168213096 19:54906105-54906127 ATAGATACACAGGAAGTGGTGGG - Intergenic
1168236448 19:55066674-55066696 AAGGAGAGAGAGGAAGAGGAAGG - Intronic
1168479455 19:56706797-56706819 ATGGAGCCACATGAAGACTCAGG - Intergenic
1168666681 19:58209843-58209865 ATGGAGCCACAGTACGATGCAGG + Intronic
1168684496 19:58339930-58339952 AAGGAGAGACAGGAACATGCTGG - Exonic
925316190 2:2926074-2926096 GTGAAGACACAGGAAGAAGATGG + Intergenic
925526838 2:4812752-4812774 AGGGAGCCAAAGGAAGAGGCAGG + Intergenic
925649120 2:6070052-6070074 ACAGAGAGACAGGAAGAGCCAGG - Intergenic
925857415 2:8143323-8143345 AGGGAGACAGAAGCAGAGGCGGG + Intergenic
926148205 2:10409754-10409776 ACTGAGGCTCAGGAAGAGGCTGG - Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926287927 2:11505386-11505408 CTGGAGAGACAGGAAGGAGCTGG - Intergenic
926332758 2:11838647-11838669 ATGAAGCCACAGGAACAGGGAGG + Intergenic
926396006 2:12443063-12443085 GAGGAGACAGAGGCAGAGGCAGG - Intergenic
926438024 2:12857305-12857327 ATTGAGAGAGAGAAAGAGGCAGG - Intergenic
926552746 2:14319659-14319681 ATTTTGACACAGGAAGAGGCTGG - Intergenic
926577853 2:14601829-14601851 ATGGAGAGAGTGGGAGAGGCAGG + Intergenic
926871115 2:17418299-17418321 AGGGAGAGATAGGAAGAGGTTGG + Intergenic
926931849 2:18048854-18048876 ATGAAGACACAGGGGAAGGCTGG - Intronic
927206438 2:20614110-20614132 ATGAAGACAAAGGCAGAGGCTGG + Intronic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927845858 2:26472666-26472688 ATGGACAGACAGGCAGAGGAAGG + Intronic
928071217 2:28219354-28219376 ATGATGACAGAAGAAGAGGCAGG - Intronic
928378914 2:30801757-30801779 ATGGAGACTGAGGAAGAGAGTGG + Intronic
928703882 2:33926929-33926951 GTGAAGACAAAAGAAGAGGCTGG + Intergenic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
929714092 2:44293134-44293156 TGGGAGACACAGGAAGAGAGAGG + Intronic
929955321 2:46453834-46453856 ATGGAGAGCCAGGTAGAGTCAGG - Intronic
930246887 2:48992678-48992700 ATAGAGACAGAGCAAGAGGGTGG - Intronic
930382837 2:50653863-50653885 AAGGAAACAAAGTAAGAGGCAGG - Intronic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
931689304 2:64821739-64821761 ATTGAGAAACAGGACTAGGCAGG - Intergenic
932580940 2:72992370-72992392 AAGGAGACACTGGATGAGGCTGG + Intronic
932607099 2:73172682-73172704 ATGGAGACCCAGGCAGGGACAGG - Intergenic
932797776 2:74712410-74712432 ATGGGGACATGGGAAGAGGGTGG + Intergenic
933992783 2:87645663-87645685 ATGGAGACAGAGGCAGAGATTGG + Intergenic
934509027 2:94922064-94922086 ATGAAGACACAGGAACATGGGGG + Intergenic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935869338 2:107428086-107428108 GTGGAGACACAGAAAGAAACAGG + Intergenic
936301073 2:111305216-111305238 ATGGAGACAGAGGCAGAGATTGG - Intergenic
936895746 2:117425552-117425574 ATGAAGACACAGGAAAAAGATGG + Intergenic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937339593 2:121082635-121082657 ATGGAGAGACAGGGAGAGGCAGG + Intergenic
937839660 2:126512592-126512614 ATGGAAACGCAGCACGAGGCAGG - Intergenic
938105111 2:128524750-128524772 ATGGGGACACAGGGAGAAGGTGG + Intergenic
938676063 2:133635204-133635226 ATGCAGACAGAGGAAAAGGAAGG + Intergenic
938698812 2:133858443-133858465 AGGGAGACAGAGGGAGAGACAGG + Intergenic
938700896 2:133878359-133878381 ATGGAGATACAGAACCAGGCAGG + Intergenic
938710119 2:133968877-133968899 ACTGAGAGACAGGCAGAGGCAGG + Intergenic
939173960 2:138728229-138728251 ATGAAGACACAGGGAGAAGATGG + Intronic
940015077 2:149095746-149095768 AGGGAGAGAGAGAAAGAGGCAGG + Intronic
942112685 2:172698268-172698290 GTGGAGAGAAAGGAAGGGGCAGG - Intergenic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
943436017 2:187866854-187866876 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436024 2:187866910-187866932 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943797735 2:192018064-192018086 ATGGAGTCACAGCAAGAGATTGG + Intronic
944052063 2:195480954-195480976 GTGGAGACACAGGGAGAAGTTGG + Intergenic
944219387 2:197287153-197287175 ATGGTGACAGTGGGAGAGGCTGG + Intronic
944426867 2:199592669-199592691 AGGCAGGCGCAGGAAGAGGCAGG - Intergenic
944448709 2:199819198-199819220 ATGGAGACACCTGGAGAGGGAGG - Exonic
944666137 2:201961240-201961262 ATGGGGGAACAGGCAGAGGCGGG + Intergenic
945126452 2:206516542-206516564 ATGAAGACACAGCAAGAAGGTGG - Intronic
945672650 2:212820676-212820698 ATTGAGAGACAGGAAGGGGTAGG - Intergenic
946015202 2:216598749-216598771 ATGGGGACCCAGGAAGATGTAGG - Intergenic
946193139 2:218018043-218018065 ATGGAGGCATATGAAGAGGCTGG + Intergenic
946327188 2:218990783-218990805 ATGGGGACCAAGGAAGAGGGTGG - Intronic
946416169 2:219540813-219540835 ATGTAGAAACAGGCAGGGGCTGG + Intronic
946473875 2:219989177-219989199 ATGAAGACAGAGGCAGAGACTGG + Intergenic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946849354 2:223890017-223890039 AGGGATACACAGAGAGAGGCAGG - Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946860738 2:223998144-223998166 ATGGAATCACAGGCAGAGGCTGG + Exonic
946869041 2:224069453-224069475 TTGGAGCCACCGGAAGCGGCAGG - Intergenic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
948111186 2:235457181-235457203 ATGAAGACAGAGGCAGAGACTGG + Intergenic
948275447 2:236704749-236704771 GTGAGGACACAGGAAGAGTCAGG + Intergenic
948299147 2:236888899-236888921 ATTGAGGCTCAGGAGGAGGCAGG - Intergenic
948307857 2:236963095-236963117 ATGAAGCCACAGGAAGAAGGTGG - Intergenic
948771504 2:240253429-240253451 ATGAAGACAGAGGCAGAGACGGG - Intergenic
949021866 2:241745312-241745334 GTGGAGACACAGCAGCAGGCAGG - Intronic
949070871 2:242023310-242023332 CTGGAGACACAGGGAGGAGCTGG + Intergenic
1168769641 20:407425-407447 AAGGAGGCCCAGGAGGAGGCTGG + Intergenic
1169402435 20:5294428-5294450 ATGCAGCCACGGGAGGAGGCAGG - Intergenic
1169458759 20:5776368-5776390 ATGAGGACACAGGAAGACGGTGG - Intronic
1169475974 20:5931521-5931543 GTGGAGACAGAGGCAGAGACTGG + Intergenic
1169497836 20:6132173-6132195 ATGGTGACAGAGGCAGAGACTGG + Intergenic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170566475 20:17610813-17610835 ATGGAGACACCTGAGGAAGCTGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171256426 20:23691974-23691996 ATGGAGTTATAGGAAGTGGCAGG + Intergenic
1171272946 20:23830568-23830590 ATGGAGTGATAGGAAGTGGCAGG + Intergenic
1171492351 20:25530004-25530026 TTGGAGACACGGGAAAGGGCTGG - Intronic
1171846455 20:30280414-30280436 GGGGAGACAGAGCAAGAGGCAGG - Intergenic
1171852137 20:30316403-30316425 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172154700 20:32815994-32816016 CTGGAGACACAGGAAGTTACAGG - Intergenic
1172227867 20:33317213-33317235 AAGGAGGCAGTGGAAGAGGCTGG - Intergenic
1172994070 20:39057208-39057230 GTGGAGACAGAGGCAGAGACTGG + Intergenic
1172996829 20:39077064-39077086 ATGGCAAGAGAGGAAGAGGCAGG - Intergenic
1173162194 20:40661301-40661323 CTGCAGAGACAGGAACAGGCAGG + Intergenic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174034061 20:47655637-47655659 TTGGAGACAGAGGAAGAACCAGG + Intronic
1174113553 20:48212411-48212433 ATGGAGATACGGGCAGAGCCTGG - Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174921978 20:54713098-54713120 ATGGGGACACAGAAAGAAGGTGG + Intergenic
1175162604 20:57020267-57020289 ACGGAGCCACAGGATAAGGCAGG - Intergenic
1175192409 20:57220182-57220204 AGGAAGACAAAGGAAGAAGCAGG + Intronic
1175369512 20:58478449-58478471 GTGGAGTCACAGGCAGAGGAAGG - Intronic
1175499080 20:59436771-59436793 AGGGAGAGAAAGGGAGAGGCAGG + Intergenic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175931102 20:62494114-62494136 ATGGAGACGCAGGCAGGGACTGG - Intergenic
1176031684 20:63015971-63015993 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031687 20:63015981-63016003 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031690 20:63015991-63016013 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031693 20:63016001-63016023 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031696 20:63016011-63016033 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176103139 20:63373605-63373627 AGGGAGTCAGAGGCAGAGGCAGG - Intronic
1176151494 20:63593611-63593633 AGGGACCCACAGGAAGAGCCAGG - Intronic
1176192304 20:63817784-63817806 GTGAAGACAGAGGCAGAGGCTGG + Intronic
1176806231 21:13486686-13486708 ATGAAGACACAGGAATATGGAGG + Intergenic
1177762860 21:25421357-25421379 AAGAGGACACTGGAAGAGGCAGG - Intergenic
1178039043 21:28619092-28619114 ATGAAGACACAGGGAGAAGACGG + Intergenic
1178062892 21:28871859-28871881 ATGAAGACAGAGGCAGAGGTTGG - Intergenic
1178192934 21:30306990-30307012 CTACAGACACAGGAAGTGGCAGG + Intergenic
1178563221 21:33658704-33658726 ATACAGACAGAGGAAGAGGTTGG - Intronic
1178632745 21:34276979-34277001 ATGGAGACACCAGATGGGGCAGG + Intergenic
1178858701 21:36271571-36271593 ATGGATACAAAGGAAGAGTCTGG - Intronic
1179361631 21:40714584-40714606 ATGGTGAGACAGGAACAGGATGG - Intronic
1179367687 21:40773401-40773423 ATGAAGACACAGGGAGAAGAAGG - Intronic
1179913045 21:44460306-44460328 ACTGAGTCACAGGGAGAGGCGGG - Exonic
1179930528 21:44568372-44568394 AAGGAAACGCAGGAAGCGGCTGG + Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1180119925 21:45739397-45739419 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180119943 21:45739452-45739474 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180239270 21:46489437-46489459 AGGGAGACACAGGCAGGGGTGGG - Intronic
1180600084 22:17009773-17009795 AGGGAGACACTGGATGAGGTGGG + Intergenic
1180991240 22:19938001-19938023 ACTGAGACAGAAGAAGAGGCTGG - Intronic
1181319756 22:21995228-21995250 ATGGAGAAACCGGAAGGGCCAGG + Intergenic
1181533861 22:23531874-23531896 ACGGAGGCACAGGCAGGGGCTGG - Intergenic
1181563281 22:23717806-23717828 TTGAAGACACATGAAGATGCAGG + Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181768756 22:25111046-25111068 GTTGAGACACAGGGAGAGGGAGG + Intronic
1181962772 22:26634891-26634913 GTGAAGATTCAGGAAGAGGCTGG - Intergenic
1182103738 22:27674447-27674469 ATGGAAACACAGACAGAGCCAGG - Intergenic
1182284206 22:29234399-29234421 ATGGAGTCACAGGAGGAATCTGG - Intronic
1182441982 22:30369993-30370015 ATGGTGACACAAGAGCAGGCAGG + Intronic
1182503766 22:30767444-30767466 ATAGAGACAGAGGAAGAGGATGG - Intronic
1182573726 22:31258753-31258775 AAGGAGACTCTGGAATAGGCTGG + Intronic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1183692813 22:39400455-39400477 AGGGAGACACAGTCAGAGCCAGG - Intronic
1183987664 22:41578308-41578330 ATGGAGAGGGAGGAAGAGCCTGG + Intronic
1184333409 22:43840030-43840052 GTGGAGTCAGAGGGAGAGGCAGG + Intronic
1184352270 22:43952148-43952170 CTGGAGGCACAGGAAGGTGCTGG - Intronic
1184450850 22:44582002-44582024 ATGGAGTCTCAGGAGGAGGCTGG - Intergenic
1184485190 22:44774060-44774082 ATGGAGACACGGGTTGAGACAGG + Intronic
1184797978 22:46742740-46742762 TTGAAGACACCAGAAGAGGCAGG - Intergenic
1184804767 22:46787319-46787341 ACGGAGACACAGAAAGCTGCTGG - Intronic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
1184978450 22:48079723-48079745 GTGGAGACAGAGGCAGAGACTGG + Intergenic
1185082139 22:48715429-48715451 ATCCAGACACAGGATGGGGCAGG + Intronic
1185086430 22:48743331-48743353 ATGCAGACAGAGACAGAGGCGGG - Intronic
1185161288 22:49231425-49231447 AAGGAGACAGAGGAAGAGCCAGG - Intergenic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950221017 3:11196185-11196207 CTGGAGACTTAGGCAGAGGCTGG - Intronic
950309118 3:11940381-11940403 AGGAAGTCACAGGAAGAGGGAGG - Intergenic
950768349 3:15290914-15290936 AGGCAGAAACAGGAAGTGGCTGG + Intronic
950857940 3:16122812-16122834 ATGGAAAGACAGGAAAAGCCTGG - Intergenic
950866730 3:16195798-16195820 ATGGAAACAGAGGATGACGCTGG - Exonic
950951681 3:17006616-17006638 ATGGAGGGAGAGGAAGAGACAGG + Intronic
952233487 3:31455540-31455562 TTTGAGCCAGAGGAAGAGGCTGG + Intergenic
952331339 3:32367039-32367061 TTGGAGACAGAGGAAGGGGTAGG - Intronic
952543212 3:34389790-34389812 ATGGAGATAATGGAAGAGGACGG + Intergenic
952975826 3:38695062-38695084 ATGGAGACACAGGAAGAAATCGG - Intergenic
953042436 3:39267283-39267305 GTGGAAACAAAGGAAGAGGATGG - Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953419702 3:42744951-42744973 ATGAAGACATAGGAAGATGAAGG + Intronic
953431984 3:42847615-42847637 AGTGAGACAGAGGATGAGGCAGG + Intronic
953482914 3:43267428-43267450 ATGGAATCACAGGAAGGAGCTGG + Intergenic
953660551 3:44888503-44888525 AGGGAGAGGAAGGAAGAGGCCGG - Intronic
953957196 3:47240586-47240608 AGGGACCCACAGGCAGAGGCTGG + Intronic
954192122 3:48970783-48970805 AGGGCGGCACTGGAAGAGGCAGG + Intronic
954305305 3:49722422-49722444 ATGGAGTTACAGGGTGAGGCAGG - Exonic
954782848 3:53073515-53073537 ATGGAGCCACGGGCTGAGGCTGG + Intronic
954947906 3:54442853-54442875 ATAGCGACTCATGAAGAGGCTGG - Intronic
954993584 3:54861817-54861839 ATGGAAACACAGGCAGGAGCTGG - Intronic
955146619 3:56326255-56326277 GTGGACACACAGGAAGAGTGCGG + Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955732204 3:61998719-61998741 ATGGAGACAGTAGAAGAAGCTGG - Intronic
955888380 3:63624479-63624501 AGGGAGGCAGAAGAAGAGGCTGG - Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
957578514 3:82040017-82040039 TTGTAGAAACAGGAACAGGCTGG - Intergenic
957973741 3:87416928-87416950 GTGGAGACACAGCAAGAAGGTGG + Intergenic
958700299 3:97580599-97580621 ATGGTGGCACAGCAAGGGGCTGG + Intronic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
961017345 3:123478506-123478528 GTGGAGAGACAGGAAAAGGCTGG + Intergenic
961074640 3:123970694-123970716 ATGGAGTCCCAGGAAGATACTGG + Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
961460269 3:127045590-127045612 AGGGAGAGAGAGGAAGAGGGAGG + Intergenic
962627597 3:137241935-137241957 TTGGAGACACAGTAAGGGCCAGG - Intergenic
962912569 3:139866858-139866880 ATGCAGACACAGGAGGACCCAGG + Intergenic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
964190580 3:153995904-153995926 ATGAAGACACAGTGAGAGGGAGG - Intergenic
964274559 3:154995802-154995824 ACGGGGTAACAGGAAGAGGCTGG - Intergenic
964620706 3:158717715-158717737 ATGTAGACAGAGCAGGAGGCTGG + Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965048137 3:163605947-163605969 ATGGAGAGAGAGAGAGAGGCTGG + Intergenic
965577053 3:170228301-170228323 ATAGAAATACAGAAAGAGGCTGG + Intronic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966458040 3:180140551-180140573 ATGGAAAGACAGAAAGAGTCTGG - Intergenic
966622436 3:181980450-181980472 ATGAAGACACTGGGAGAAGCTGG + Intergenic
966752046 3:183331388-183331410 GTGGGGCCACAGGAAGAGACAGG - Intronic
966931676 3:184679378-184679400 ATGGGGGGATAGGAAGAGGCCGG - Intronic
966978089 3:185104179-185104201 ATGGACACAAAGGATGAGGTTGG - Intronic
967202097 3:187080981-187081003 ATGAGGACACAGGAAGCGGGTGG - Intergenic
967442747 3:189527888-189527910 AAGCACACATAGGAAGAGGCTGG + Intergenic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
968042276 3:195598803-195598825 GTGGAGACAGAGGGAGAGTCAGG - Intergenic
968055092 3:195685206-195685228 ATGCACACACAGGAAAAGGTAGG - Intergenic
968075031 3:195811706-195811728 ATGGAGACAGCAGATGAGGCTGG - Intronic
968100808 3:195964011-195964033 ATGCACACACAGGAAAAGGTAGG + Intergenic
969033514 4:4231840-4231862 AAGCAGAAACTGGAAGAGGCTGG - Intergenic
969176400 4:5402307-5402329 ATGGAGCCACAGGCACAGGCCGG + Intronic
969322305 4:6419853-6419875 ACAGAGACACAGGGAGAGGAAGG - Intronic
969632673 4:8347468-8347490 ATGGAGAAACAGGCAGCAGCTGG - Intergenic
969903527 4:10371959-10371981 GTGGAGCCACAGGCAGAGGGAGG - Intergenic
970493599 4:16602478-16602500 ATGAGGTCACAGAAAGAGGCAGG + Intronic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971129878 4:23796071-23796093 ATGGATATATAGGAAGAGGATGG + Intronic
971356264 4:25897810-25897832 ATGAAGACAGAGGCAGAGACTGG - Intronic
971413887 4:26404825-26404847 AAGTAGACACAGGAAGTGGGAGG - Intronic
971629322 4:28969351-28969373 ATGAAGACACAGCAAGAAGGAGG + Intergenic
971946302 4:33282860-33282882 ATGAAGACACAGGAAGAAAGTGG - Intergenic
972031015 4:34458241-34458263 ATACAGACACAGACAGAGGCAGG + Intergenic
972560185 4:40220189-40220211 ATGCAGGCAGAGGAAGCGGCTGG - Intronic
974837452 4:67268115-67268137 ATGGAAACAAAGAAAGAGGGAGG - Intergenic
975043827 4:69777538-69777560 ATGGAGAAAGAGGAAGACGATGG + Intronic
975095882 4:70455893-70455915 AGGGAGGCACAAGAAGAGGGTGG - Intronic
975260059 4:72287512-72287534 AGAGAGAGCCAGGAAGAGGCAGG + Intronic
975769766 4:77708526-77708548 GTGGGGGCACAGGAAGAGGGAGG - Intergenic
976316835 4:83667478-83667500 AGGAAGACACACAAAGAGGCGGG + Intergenic
976608142 4:87001828-87001850 AAGCAGACACAGGAAGAGGGAGG - Intronic
978560636 4:110030151-110030173 ATGGAGACACTGGTAGAGCCAGG + Intergenic
979312427 4:119219379-119219401 ATGATGACAGAGGCAGAGGCTGG - Intronic
979565265 4:122147593-122147615 GTGAAGACACAGGAAGAAGATGG + Intergenic
979973057 4:127161576-127161598 TGGGAGACAGAGGAGGAGGCAGG - Intergenic
980115814 4:128678169-128678191 ATGGAGAGACAGGGAGATGAGGG - Intergenic
980359660 4:131748585-131748607 GGGGAGACACAGGAAAAGGGAGG - Intergenic
980579171 4:134727461-134727483 ATGGAGTCAAAGGAAGAGGAAGG + Intergenic
980800397 4:137741133-137741155 GTGAAGACACAGGAAGAAGGTGG + Intergenic
980894175 4:138845527-138845549 AGGGAGACACTGGGAGAGGAGGG + Intergenic
981390003 4:144178333-144178355 ACAGAGAGACAGAAAGAGGCTGG - Intergenic
981444434 4:144819309-144819331 GTGAAGACACAGGAAGAAGACGG - Intergenic
982043682 4:151420426-151420448 ATGGGGAAAAAGGAAGAGGTAGG - Intronic
983190474 4:164749069-164749091 ACTGAGACAGAAGAAGAGGCTGG - Intergenic
984652705 4:182287282-182287304 ATGGAGACAGAGAACCAGGCAGG - Intronic
985228437 4:187788821-187788843 AAAGAGACACAGGATGAGCCGGG + Intergenic
985480393 5:107012-107034 GTGCAGACATGGGAAGAGGCTGG + Intergenic
985502267 5:255845-255867 ATGCACACACAGGAAAAGGTAGG - Intronic
985657834 5:1141171-1141193 ACAGAGACACAGGGAGAAGCTGG - Intergenic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985759012 5:1735184-1735206 AGGGAGGGACAGGAAGAAGCTGG + Intergenic
985824322 5:2181392-2181414 GTGAAGACAGAGGGAGAGGCTGG - Intergenic
985902449 5:2807050-2807072 ATGGAGGCAGAGGAAGACACAGG + Intergenic
986102131 5:4622799-4622821 ATGATGCCACAGGAAGAGGTGGG + Intergenic
986329091 5:6704400-6704422 TTAGAGACACAGACAGAGGCTGG - Intergenic
986383827 5:7211481-7211503 GTGAAGACAGAGGTAGAGGCTGG - Intergenic
986722918 5:10572784-10572806 AGGGAGGCCCAGGAAGAAGCAGG - Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987173191 5:15280097-15280119 GTGAAGACACAGGGAGAAGCTGG + Intergenic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
988065433 5:26225306-26225328 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
988083372 5:26441630-26441652 ATAGAGTCACAGAAAGAGCCTGG + Intergenic
988422815 5:31026889-31026911 ATGAAGACACAGGGAGAAGATGG + Intergenic
988998896 5:36740946-36740968 ATGAAGACACAGGGAGAACCTGG - Intergenic
989081927 5:37631610-37631632 AAGGACATACAGTAAGAGGCAGG + Intronic
989164773 5:38423524-38423546 CTGGATCCACAGGAAGAAGCGGG - Intronic
990335238 5:54765839-54765861 ATGAAGACACAGGGAGGGGCTGG + Intergenic
991335884 5:65546735-65546757 GTGAAGACACAGGAAGAAGATGG + Intronic
992163790 5:74028454-74028476 ATGTAGATGCAGGTAGAGGCTGG - Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992883806 5:81137671-81137693 GTGAAGACACAGGAAGAAGACGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
992971392 5:82062628-82062650 ATGGAGAAACATGAAGGAGCAGG + Intronic
995138242 5:108703514-108703536 ATCGAGAGAAAGGAAGAGGGAGG - Intergenic
997015641 5:129931161-129931183 ATGGAGACACATGTGTAGGCCGG - Intronic
997372499 5:133370862-133370884 ATGGAGCAACAGGGAAAGGCAGG + Intronic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
998295906 5:140968315-140968337 ATGGAGACATAGGAGGTGACTGG - Exonic
998337291 5:141384397-141384419 ATGGAGACATAGGAGGACACTGG - Exonic
998352948 5:141512880-141512902 CGTGAGACACAGGAAGAGGGTGG - Exonic
998810811 5:145964126-145964148 AAGGAAAGAAAGGAAGAGGCCGG - Intronic
998985187 5:147748959-147748981 ATGCAGACACACGAAGAGTGAGG - Intronic
999020653 5:148162242-148162264 ATAGAGACACAGAAACAGACAGG + Intergenic
999087424 5:148905040-148905062 ACTGAGACACAGAAAGGGGCAGG - Intergenic
999246452 5:150157554-150157576 CAGGTGACACAGGTAGAGGCTGG + Intergenic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999383645 5:151139388-151139410 ACGGAGCAACAGGCAGAGGCAGG - Exonic
999493607 5:152075182-152075204 ATGAAGACAGAGGCAGAGCCTGG - Intergenic
999685161 5:154096214-154096236 ATGGTGACTCAGCAGGAGGCAGG - Intronic
1000330188 5:160199674-160199696 ATGGAGACGAAGGAGGGGGCAGG - Intronic
1000380782 5:160627469-160627491 ATGTAGACACTGGCAGAGGTGGG + Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000398269 5:160798471-160798493 ATGAAGACAGAGGTAGAGGTTGG + Intronic
1001272032 5:170320102-170320124 TTGAAGACAGAGGAAGAGACTGG - Intergenic
1001283088 5:170402062-170402084 ATGAAGACAGAGGCAGAGCCTGG - Intronic
1001307193 5:170584013-170584035 ATGGAGGCACTGGATGGGGCTGG + Intronic
1001674493 5:173500681-173500703 ATGAAGACAGGGGCAGAGGCTGG + Intergenic
1002000004 5:176192117-176192139 ATGGAGACACAGGAGGGACCTGG + Intergenic
1002374927 5:178781951-178781973 CTGGATACACAGGCAGCGGCCGG - Intergenic
1002702112 5:181131453-181131475 AGGGAGACACAGGAAGACCGGGG + Intergenic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1003150471 6:3543681-3543703 ATGGAGACAGAGGGAGAGAGAGG - Intergenic
1003662394 6:8074896-8074918 AGTAAGACACAGGAAGAAGCGGG + Intronic
1004585481 6:16995501-16995523 ATAGAGAGACAGGAAAAGGCAGG - Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005964436 6:30717059-30717081 ATGAAGACACAGGGAGACGTCGG - Intronic
1005994313 6:30922260-30922282 CTGGAGTCACAGAAAGCGGCAGG - Intronic
1006128703 6:31855352-31855374 AGGGAGACAGAGGGAGAGGGAGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006711622 6:36077986-36078008 ATACAGACACAAGAAGAGGAAGG - Intronic
1006730131 6:36230398-36230420 ATGCAAGCACAGTAAGAGGCTGG - Intronic
1007240241 6:40419671-40419693 ATGAAGACAGAGACAGAGGCAGG - Intronic
1007407822 6:41644964-41644986 AGGGGGACACAAGGAGAGGCAGG - Intronic
1009061499 6:58402279-58402301 ACTGAGACAGAGGGAGAGGCTGG - Intergenic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1010134264 6:72532091-72532113 AGGGAGCCACAGGGAGTGGCAGG - Intergenic
1010134471 6:72534285-72534307 ATGGAAACAAAGGAGGAGTCAGG + Intergenic
1010777689 6:79905999-79906021 GTGAAGACACAGGCAGAGACTGG - Intergenic
1010966372 6:82213850-82213872 AGGGAGAGAGAGGAAGAGGAGGG + Intronic
1011248937 6:85349891-85349913 GTGAAGACACAGGCAGAGGGTGG - Intergenic
1011375598 6:86682744-86682766 ATAGAGATAGAGGAAGCGGCAGG - Intergenic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1012049277 6:94319681-94319703 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012651706 6:101762141-101762163 ACAGAGACAGAGGAAGAGGAAGG - Intronic
1013465102 6:110411058-110411080 AAGGTGACAGGGGAAGAGGCTGG - Intronic
1013627318 6:111950958-111950980 ATTGACACAGAGGAAGAGGGAGG + Intergenic
1013865377 6:114690210-114690232 ATGAAGACATAGGAAGAAGATGG - Intergenic
1013970443 6:116011806-116011828 GTGGAAACACAGGTAGATGCAGG - Intronic
1014796213 6:125727740-125727762 ATTGACTCACAGGCAGAGGCAGG + Intergenic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015590287 6:134816539-134816561 AGTGAGACACAGTGAGAGGCTGG + Intergenic
1017159863 6:151354781-151354803 CAGGAGACAGAGGCAGAGGCAGG - Intronic
1017219617 6:151950628-151950650 GAAGAGACACAGGAAGAGGACGG + Intronic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1018212612 6:161496781-161496803 AGGGAGACACAGCAAGAAGGTGG + Intronic
1018739213 6:166714608-166714630 CTGGAGACAGAGGCAGAGGCGGG + Intronic
1019141649 6:169950730-169950752 GTGGCAACACAGGAACAGGCTGG - Intergenic
1019404887 7:877866-877888 GTGGAGACAGAGGAAGGGGAGGG - Intronic
1019415110 7:923498-923520 AGGGTGACACAGGAAGAGACGGG + Intronic
1019532088 7:1508709-1508731 ATGGAGTCAGAGGCAGAGGCTGG - Intergenic
1020928911 7:14368822-14368844 AGGTAGGCACAGGAAGAGCCCGG + Intronic
1021281763 7:18728300-18728322 CTGTAGACAAAGGAAGAGGTTGG - Intronic
1021400231 7:20201498-20201520 ATGCAGAGAAAGGCAGAGGCTGG + Intronic
1021471231 7:21003867-21003889 ATGCAGCCACCAGAAGAGGCAGG - Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1024182448 7:46909691-46909713 AAGAAGACAAATGAAGAGGCTGG + Intergenic
1024242948 7:47449358-47449380 AGGGAGGCACATGAGGAGGCAGG - Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024920916 7:54553853-54553875 TTGGAGACACTGGATGAGACAGG - Intronic
1024922777 7:54577336-54577358 ATGGTGAAAAAGGAAGAGGCAGG - Intergenic
1025073700 7:55924393-55924415 AGGGAGATACAGAGAGAGGCTGG - Intronic
1025818589 7:64942927-64942949 AGGGACGCACAGGAAGATGCAGG + Intergenic
1026201424 7:68217949-68217971 ATAGAGCCACAGGGAGAGGTTGG - Intergenic
1026250546 7:68666224-68666246 AAGGAGACAGAGAGAGAGGCAGG - Intergenic
1026461497 7:70619092-70619114 AGGGAGACCCAGGGAGAGCCTGG - Intronic
1026610405 7:71854206-71854228 ATGGAGAGAAAGAAACAGGCCGG + Intronic
1026639393 7:72110882-72110904 ACGGAGACATTGGAACAGGCAGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1028949670 7:96620331-96620353 TAGGAGACAGAGGGAGAGGCTGG - Intronic
1029138760 7:98394713-98394735 ATAGAGACACAGGAGCAGACTGG - Intronic
1029187284 7:98748279-98748301 AAGGAGAAAGAGGGAGAGGCAGG + Intergenic
1029293978 7:99524803-99524825 ATGAATTCACAGGAAGAGGAAGG + Intronic
1029374688 7:100170586-100170608 AGGGAGACACAGGTGGATGCCGG + Intronic
1029614429 7:101647444-101647466 ATGGAGGCACAGGAAGTAACTGG + Intergenic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1030172388 7:106616473-106616495 AAGGAGAGAGAGGAAGAGGAGGG + Intergenic
1030908933 7:115222721-115222743 ATGAAGACAGAGAAAGAGCCTGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1032070014 7:128798688-128798710 AGGGAGACACAAGAGGAAGCTGG - Intronic
1032474384 7:132202341-132202363 TTAGAGACAAAGGAAGGGGCTGG + Intronic
1033140468 7:138821888-138821910 ATGGAGAGACAGGAGGCAGCGGG + Intronic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1034675838 7:152891912-152891934 ATGAAGACACAGGGAGAAGACGG + Intergenic
1035050096 7:155993774-155993796 GTGAAGACACAGGGAGAGGGCGG - Intergenic
1035078184 7:156194895-156194917 AGGGAGAGACAGGCAGAGCCAGG + Intergenic
1035206728 7:157298506-157298528 ATTGAGACACAGGGACAGGGAGG + Intergenic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1036093045 8:5690370-5690392 GTGAAGACACAGGGAGAAGCTGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036147251 8:6265495-6265517 ATGGTGACAGAGGAGCAGGCAGG + Intergenic
1037329681 8:17732093-17732115 ATGCAGTCACAGGAAGTGGTGGG + Intronic
1037396571 8:18449907-18449929 ATGAAGACACAGGAAGAAGGTGG - Intergenic
1037581303 8:20247379-20247401 ACGGAGACAGAGGAAAGGGCTGG - Exonic
1037771660 8:21804605-21804627 GTGGGGACAGAAGAAGAGGCAGG - Intronic
1038018163 8:23532168-23532190 AAGAAGACACAGGAAGCAGCAGG - Intronic
1038134068 8:24766884-24766906 ATGAAGACACAGGAGCAAGCTGG + Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1038992093 8:32878950-32878972 ATGGAAATACAGGAAAAGGGTGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1040041646 8:42921806-42921828 ATGGAGGAATAGGAAAAGGCTGG + Intronic
1040873419 8:52124688-52124710 CTGGAAAGACTGGAAGAGGCAGG + Intronic
1040905436 8:52465132-52465154 CTGGAGAGACAGGGATAGGCTGG + Intergenic
1041067205 8:54093415-54093437 ATGAAGACAGAGGCAGAGGTTGG + Intronic
1041489209 8:58412749-58412771 ATGAAGACACAGGATCAGACAGG - Intronic
1041741832 8:61164737-61164759 ATACAGACACAGAAAGAGGGGGG - Intronic
1041810332 8:61901890-61901912 ATGGAGACAAGGATAGAGGCCGG - Intergenic
1042170443 8:65985814-65985836 GAGGAGAGAGAGGAAGAGGCAGG - Intergenic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042473167 8:69214177-69214199 ATGAAGACACAGGGAGAAGATGG + Intergenic
1043208342 8:77476345-77476367 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1043756422 8:84009517-84009539 AAGGAGACAGAGGCAGAAGCAGG + Intergenic
1045037418 8:98186561-98186583 ATGGGGTCACACGAAGAGGAAGG - Intergenic
1045353551 8:101364282-101364304 ATGAACACACAGGAAAAGGAAGG - Intergenic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1045483542 8:102612259-102612281 ATGGCGAGAGAGGAAGAGGCAGG + Intergenic
1045660550 8:104433063-104433085 GTGAAGACACAGGAAGAAGATGG + Intronic
1045778312 8:105833212-105833234 GTGGAAAGAAAGGAAGAGGCAGG + Intergenic
1045889954 8:107143949-107143971 ATGGAGACAAAAGAAGAGAGTGG + Intergenic
1046220906 8:111213138-111213160 ATGAAGACAAAGGCAGAGACTGG + Intergenic
1046581751 8:116101885-116101907 AGGGAGATAAAGGAAGAGGGAGG - Intergenic
1046606140 8:116374195-116374217 ATTGGGTAACAGGAAGAGGCTGG - Intergenic
1046613715 8:116453148-116453170 CAGGAAACACAGGAAGAGACAGG - Intergenic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047064523 8:121265612-121265634 ATGAAGACAGTGGAAGAGGCTGG + Intergenic
1047189504 8:122665256-122665278 ATGAAGACACAAGAAAAGGTTGG - Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047248620 8:123165489-123165511 ATGGAAGTGCAGGAAGAGGCCGG - Intergenic
1047525322 8:125628125-125628147 AGGGAGCCACATGAAGAGGCTGG - Intergenic
1047623101 8:126628429-126628451 TGTGAGACACAGGCAGAGGCAGG + Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048066985 8:130980113-130980135 ATGAAGACAGAGGCAGAGGTTGG - Intronic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048184528 8:132227434-132227456 ATGAAGACACAGTGAGAAGCCGG + Intronic
1048570956 8:135655558-135655580 CTGGAGACAGAGGAAGGGGCTGG + Intronic
1048668442 8:136690326-136690348 ATGGTGTAACAGGCAGAGGCTGG - Intergenic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1048907508 8:139102617-139102639 ATGTAGCCTTAGGAAGAGGCAGG + Intergenic
1049176728 8:141197362-141197384 GTGAAGACAGAGGCAGAGGCAGG + Intergenic
1049249659 8:141581559-141581581 AGAGAGAGACAGAAAGAGGCGGG + Intergenic
1049774183 8:144397079-144397101 GTGGAGCCACGGGAAGGGGCGGG + Intronic
1049774201 8:144397119-144397141 GTGGAGCCACGGGAAGGGGCGGG + Intronic
1051344436 9:16139654-16139676 ATGGAGACACAGGACAGAGCTGG + Intergenic
1052067319 9:24038142-24038164 ATGAAGGCACAGGAAGTGACTGG - Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053163581 9:35829537-35829559 ATGGGGACCCAGGCAGGGGCTGG - Exonic
1053786051 9:41653675-41653697 AGAGAGAGACAGGGAGAGGCAGG - Intergenic
1053789918 9:41679661-41679683 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054178257 9:61891350-61891372 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054475012 9:65566204-65566226 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054659272 9:67689474-67689496 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054757759 9:68976499-68976521 AAGGAGCTACAGCAAGAGGCAGG - Intronic
1055122606 9:72679631-72679653 ATGGAGACACAGCAAATGGATGG - Intronic
1055262138 9:74449476-74449498 ATGAAGACACAGGGAGAAGATGG - Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055639176 9:78306145-78306167 ATGGTAACAAAGGATGAGGCTGG + Intronic
1056270299 9:84940910-84940932 AAGGAGGCACCGGAAGAGGGAGG - Intronic
1056589619 9:87955634-87955656 TTAGAGAGACAGGAAGAGGCAGG - Intergenic
1058482531 9:105411391-105411413 ATGGAGACAGAGCAAGAGAGAGG - Intronic
1058820027 9:108721317-108721339 CTGTAGACACGGGAAGACGCGGG + Intergenic
1058848670 9:108988467-108988489 ATGGAGACAAGGGCAGAGGCAGG - Intronic
1058935235 9:109763822-109763844 ATGGAGACAGAGGCAGAGATTGG - Intronic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059198958 9:112396818-112396840 ACTGAGACAGAAGAAGAGGCTGG + Intronic
1059496994 9:114718239-114718261 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060050930 9:120377625-120377647 ATGCAGACACAGCAAGAAGATGG - Intergenic
1060115957 9:120940912-120940934 ATGCAGACACTGGGAGAGGACGG - Intergenic
1060316599 9:122516979-122517001 AAGGAGACTCAGGAAATGGCAGG + Intergenic
1061001547 9:127905565-127905587 TTGGACACCCAGGATGAGGCAGG + Intergenic
1061105928 9:128530478-128530500 ATGGAGACAAAGGGAGAGTCAGG - Intronic
1061204080 9:129153005-129153027 ATACAGACACAGGAGGGGGCAGG + Intergenic
1061395098 9:130339475-130339497 AGAGAGACACAGGAACAGGGAGG + Intronic
1061410338 9:130417609-130417631 GTGGAGACAGAGGCAGAGGATGG + Intronic
1061488062 9:130930306-130930328 GTGGAGACATAGGGAGAGACGGG + Intronic
1061488073 9:130930356-130930378 AGGGAGACACAGGGAGACGCAGG + Intronic
1061488076 9:130930366-130930388 AGGGAGACGCAGGGAGATGCGGG + Intronic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1061878148 9:133555126-133555148 ATGAGGACAAAGGCAGAGGCTGG - Intronic
1062167241 9:135113948-135113970 ATGGAGCCACGAGACGAGGCAGG - Intronic
1062190541 9:135245744-135245766 GTGGAGACGGAGGCAGAGGCTGG - Intergenic
1062376591 9:136264522-136264544 ACGGAGAAACAGGAAAAGGCAGG - Intergenic
1062486259 9:136777835-136777857 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
1062514823 9:136927527-136927549 CTGAAGACACGGGAAGAGACTGG - Intronic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1062721181 9:138044988-138045010 ATGGAAACACAGGAAGGCACTGG + Intronic
1062722850 9:138053539-138053561 GTGGAGCCACAGGGAGGGGCCGG - Intronic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185511196 X:666373-666395 GTGGAGACAGAGGCAGAGACTGG + Intergenic
1185523957 X:762313-762335 GTGGAGACAGAGGCAGAGACTGG - Intergenic
1185548545 X:965668-965690 ATGGAGATAGAGGCAGAGACTGG - Intergenic
1185568520 X:1114932-1114954 ATGGAGACGGAGGCAGAGACTGG + Intergenic
1185579875 X:1203603-1203625 ATGGAGACGGAGGCAGAGACTGG + Intronic
1185611156 X:1394423-1394445 AGGGAGAGACAGGGAAAGGCAGG - Intergenic
1185611174 X:1394502-1394524 AGGGAGAGACAGGGAAAGGCAGG - Intergenic
1185616831 X:1427157-1427179 GTGGAGACAAAGGCAGAGACTGG + Intronic
1185677109 X:1857984-1858006 ATGGAGACAGAGGCAGAGACTGG - Intergenic
1185677399 X:1859900-1859922 GTGGAGACAGAGGCAGAGACTGG - Intergenic
1185680510 X:1884984-1885006 ATGGAGACGGAGGCAGAGACTGG - Intergenic
1185681772 X:1894216-1894238 AGGAAGACACAGAAAGAGACAGG - Intergenic
1185699009 X:2216297-2216319 GTGGAGACAGAGGCAGAGACTGG + Intergenic
1185722908 X:2396109-2396131 GTGGAGACAGAGGCAGAGACTGG - Intronic
1185735442 X:2492328-2492350 ATGGAGACAGAGGCCGAGACTGG + Intronic
1185773885 X:2786827-2786849 ATGAAGACACAGGGAGAAGACGG + Intronic
1185792620 X:2938898-2938920 GTGGAGACAGAGGCAGAGACTGG + Intronic
1185831333 X:3305631-3305653 GTGGAGACAGAGGCAGAGACTGG - Intergenic
1185837058 X:3354587-3354609 GTGGAGACAGAGGCAGAGACTGG - Intergenic
1185838820 X:3369640-3369662 GTGGAGACAGAGGCAGAGACTGG - Intergenic
1185874993 X:3694816-3694838 GTGGAGACAGAGGCAGAGACTGG + Intronic
1186129250 X:6448581-6448603 ATGAAGACACAGGGAGAAGATGG - Intergenic
1186168509 X:6852840-6852862 ATGGATACAAAGGATGAGGTTGG + Intergenic
1186246614 X:7622471-7622493 ATGGAGGGAGAGGAAGAGGAAGG - Intergenic
1186488676 X:9953968-9953990 ACTGAGTAACAGGAAGAGGCTGG - Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187292439 X:17968117-17968139 ATGTAAACAAAGGAATAGGCTGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188368415 X:29338714-29338736 ATGGAGAGACAGACAGAGACAGG - Intronic
1188459346 X:30405440-30405462 ATGAAGATACAGGAAGAAGGTGG - Intergenic
1188701979 X:33276281-33276303 CAGGAAACACATGAAGAGGCTGG + Intronic
1189339077 X:40190858-40190880 AGGGAGACACACCAAGAGGGAGG + Intergenic
1189379082 X:40489018-40489040 AGAGAGATACAGGAAGAGGTAGG - Intergenic
1190193071 X:48293775-48293797 TCTGAGACACAGGTAGAGGCAGG + Intergenic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1191881634 X:65848587-65848609 GTGGGGACAGAGGCAGAGGCTGG + Intergenic
1193426777 X:81349126-81349148 ATGGGGTTACAGGAAGAGGAGGG - Intergenic
1193988161 X:88272876-88272898 ATGAAGACACAGGGAGAAGATGG - Intergenic
1195299372 X:103511980-103512002 GTGGTGACAGAGGAAGAGACTGG + Intronic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1196110676 X:111943847-111943869 GTGGAGTGAGAGGAAGAGGCTGG - Intronic
1196121289 X:112053665-112053687 ATGGAGATATAGGAAGGGGGAGG + Intronic
1196750906 X:119116448-119116470 ATGGGGACAGGGGAAGAGGCAGG - Intronic
1196824836 X:119732859-119732881 ATAAAGACATAGGCAGAGGCCGG + Intergenic
1197286660 X:124603027-124603049 ATGAAGACAGAGGCAGAGACTGG + Intronic
1197605707 X:128582574-128582596 ATGGACACAAAGGGTGAGGCTGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198910169 X:141604895-141604917 ATGGAGACAAAGGGAAAGACAGG + Intronic
1199133293 X:144220144-144220166 ATAGAGACAAAGGAAGAGGCAGG - Intergenic
1199845752 X:151692122-151692144 GTGGAGACACAGGGAGAGTGTGG - Intergenic
1199948761 X:152688691-152688713 GTGAAGACACAGGAAGAGAATGG + Intergenic
1199960915 X:152779758-152779780 GTGAAGACACAGGAAGAGAATGG - Intergenic
1200532994 Y:4359890-4359912 GTAGAGACACAGGAAGAGGTGGG + Intergenic
1200774986 Y:7162323-7162345 AAGAACACACAGGAAGATGCTGG + Intergenic
1200789955 Y:7290940-7290962 TTGGAGACAGAGGCAGAGACTGG - Intergenic
1200916041 Y:8572090-8572112 ATGGAGAGACAGTAGGAGTCCGG + Intergenic
1201237428 Y:11924524-11924546 TTGGAGACAGAGGCAGAGACTGG + Intergenic
1201239511 Y:11945163-11945185 ATGGAGACAGAGGCAGAGACTGG + Intergenic
1201280528 Y:12338469-12338491 ATAGAGACAGAGGCAGAGACTGG - Intergenic
1201295812 Y:12462325-12462347 ATGAAGACACAGGGAGAAGACGG - Intergenic
1201475660 Y:14378244-14378266 ACTGAGACAGAAGAAGAGGCCGG + Intergenic
1201516626 Y:14825241-14825263 AGGGAGAGACAGGAAGAGAGAGG - Intronic
1201540081 Y:15096565-15096587 ATGGAGACACATGGAGAGGGAGG - Intergenic
1201906707 Y:19092907-19092929 ATGGAGACAAAGACAGAGACTGG - Intergenic