ID: 1148446253

View in Genome Browser
Species Human (GRCh38)
Location 17:47739368-47739390
Sequence GCCTCCCGAGTCACCCGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148446253_1148446259 5 Left 1148446253 17:47739368-47739390 CCCGCTCGGGTGACTCGGGAGGC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1148446259 17:47739396-47739418 CAGGAGGATTGCCTGTGCCCAGG 0: 2
1: 272
2: 5560
3: 22063
4: 89174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148446253 Original CRISPR GCCTCCCGAGTCACCCGAGC GGG (reversed) Intronic
902244623 1:15112476-15112498 GCCTCCAGCGTCACGCGGGCAGG + Exonic
904273202 1:29363773-29363795 GCCTCCAGAGTCAGCCTGGCTGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905153913 1:35957233-35957255 GCCTCCCAAGTAATCCAAGCTGG - Intronic
908174347 1:61539615-61539637 GCCTCTGGAGTCACCCAGGCTGG + Intergenic
909034532 1:70581989-70582011 GCCTCCTGAAGCACCCAAGCAGG - Intergenic
910427637 1:87132420-87132442 GCCTCCCGAGGCCGCCGCGCCGG - Intronic
915357210 1:155262474-155262496 GCCTTCCTAGTCTCCCGAGATGG + Intergenic
920118083 1:203635387-203635409 GCCTCCCAAGTAACTGGAGCAGG + Intronic
923511184 1:234655348-234655370 GTCTCCGGAGGCACCCGAGGTGG - Intergenic
1076935430 10:133565544-133565566 CCCTCCCGAGGCACCCTCGCTGG - Exonic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1089467641 11:118695763-118695785 GCCTCCCGGGGCAGCAGAGCTGG + Intergenic
1096650007 12:53057908-53057930 GCCTCCCTAGACACCTGGGCAGG + Intronic
1097981889 12:65743734-65743756 GCCTCCAGAGTAACCCGTGGCGG + Intergenic
1099162729 12:79264207-79264229 GTCTCCTGTGTCACCCAAGCTGG + Intronic
1103330929 12:120153670-120153692 GCCTCCCGTGTCTCCTTAGCGGG + Intronic
1105475124 13:20721988-20722010 GCATCCCGAGGCGCCCAAGCTGG + Exonic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1121325966 14:93019758-93019780 GCCTCCCCAGTCTCAGGAGCTGG - Intronic
1121498313 14:94413163-94413185 GCCTCCCTTATCACCCCAGCAGG - Intergenic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1136176472 16:28520476-28520498 GCCTCCTGAGTCACTGTAGCTGG - Intergenic
1138572455 16:57884465-57884487 GCCTCACGAGTCACCCTTTCTGG - Intronic
1141017239 16:80461913-80461935 GCCTCCCAAGTCAGCATAGCTGG - Intergenic
1141959008 16:87392275-87392297 GCGTCGCGAGTCACCTGACCAGG + Exonic
1142051711 16:87963119-87963141 GACTCCCAGGCCACCCGAGCTGG - Intronic
1144760521 17:17704486-17704508 GCCTCCCCAGGCACCCGTGCCGG + Intronic
1147323752 17:39660649-39660671 TCCTCCCGACCCTCCCGAGCAGG - Intronic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1151404768 17:73879110-73879132 GACTCCCGAGTCCCTCGTGCAGG - Intergenic
1153515194 18:5895539-5895561 GCCCCCCGACTCCGCCGAGCCGG - Intronic
1153591992 18:6683699-6683721 GGCTCAGGAGTCACCCAAGCAGG - Intergenic
1154294798 18:13138547-13138569 GCCTCCCGAGGTACAAGAGCAGG - Intergenic
1156488934 18:37485251-37485273 GCGTCCCGGGTCCCCGGAGCGGG - Intronic
1157260793 18:46174221-46174243 GCGTCCTGAGTCACCGCAGCGGG + Exonic
1158913303 18:62091222-62091244 GCCTCCCGAGTTAGCTGGGCAGG - Intronic
1161140872 19:2647085-2647107 TCCCCCCGAGTCCCCCGAGGTGG - Intronic
1162316620 19:9942881-9942903 ACCTCCCAACTCACCCAAGCAGG - Intergenic
1162584299 19:11549723-11549745 GACTCCCGAGTACCCAGAGCTGG + Exonic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1167381405 19:49140281-49140303 ACCTACCCAGTCACCCAAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
934553681 2:95276704-95276726 CCCCACCGAGGCACCCGAGCAGG - Intronic
935684977 2:105675133-105675155 GCATCCTGGGTCACCGGAGCTGG - Intergenic
937478553 2:122236610-122236632 GCCTCCTGAGTAACCCCAGATGG - Intergenic
947749034 2:232523408-232523430 GCCTCCCGAGTCACCCTGCGGGG - Exonic
948853298 2:240718691-240718713 TCCTCCGGAGTCACCCAAGGTGG - Intronic
1169849653 20:10035254-10035276 GCCTCCCCGGTCGCCCCAGCAGG + Exonic
1175074056 20:56358962-56358984 GCCTCCCGGGTCAGCGGCGCGGG + Exonic
1175419306 20:58821295-58821317 GCCTGCCAAGTCACAGGAGCTGG - Intergenic
1176372111 21:6068500-6068522 GCCTCCCCAGGCACTGGAGCTGG + Intergenic
1179751408 21:43470039-43470061 GCCTCCCCAGGCACTGGAGCTGG - Intergenic
1179939470 21:44628478-44628500 GCCCCCCGAGGCCCCCCAGCTGG - Intronic
1180049058 21:45323111-45323133 GCCTCCCGAGAGCCCCGTGCAGG - Intergenic
1181069323 22:20322662-20322684 GCCTCCCGAGTCCACCAGGCTGG + Intergenic
1185251450 22:49803893-49803915 GCATCCCCAGTCCCCAGAGCTGG + Intronic
954406423 3:50347824-50347846 TCTTCCCGAGTCACCCGCACAGG + Exonic
961102227 3:124209390-124209412 GCCTCCCCAGTCCCACTAGCTGG - Intronic
961108065 3:124259145-124259167 GCCTCCCCAGTCTCCCCAGAAGG - Intronic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
967217126 3:187220227-187220249 GCCTCCAGAGTCACCCGCACAGG + Intronic
969466081 4:7357203-7357225 CCCTCCCGAGTCCCCGGGGCAGG - Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
969663514 4:8544103-8544125 CCCTCTCAAGTCACCTGAGCAGG - Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
985633914 5:1026834-1026856 GCCTCCCGAGTGCCCTGAGGTGG + Intronic
986365203 5:7022241-7022263 GCCTGCCCAGGCACCTGAGCTGG + Intergenic
988932582 5:36051113-36051135 GCCTCCCTCCTCACCCAAGCTGG - Intronic
997647057 5:135488835-135488857 GCCTCCCGAAGGACCCGAGGAGG - Intergenic
997747538 5:136312174-136312196 GCCTCCCCAGTAACCCAAGTGGG - Intronic
998095761 5:139394809-139394831 GCCTCGCGGGAAACCCGAGCCGG + Exonic
998407800 5:141883642-141883664 AGCTCCCGAGCCACCAGAGCTGG - Intergenic
1003403454 6:5809620-5809642 GCCTCCCGAGCCATCGGTGCAGG + Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007584440 6:42980203-42980225 GCCTCCCGAGTAACTGTAGCCGG + Intergenic
1007780070 6:44247570-44247592 CCGTGCTGAGTCACCCGAGCGGG - Intronic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1008673146 6:53794099-53794121 GCCTCCCCGGTCATCCGGGCTGG + Intergenic
1010980556 6:82364901-82364923 GCCTCCCGAGCCTTCGGAGCGGG + Exonic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1012131333 6:95497246-95497268 GCATCCCGAGCCTCCCCAGCGGG + Intergenic
1015654170 6:135497955-135497977 GCCTCCCCGGCCACGCGAGCGGG + Intergenic
1019660658 7:2222192-2222214 GCCTCCCGAGTCCCACAGGCTGG + Intronic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026015715 7:66669308-66669330 CCCTCCCCAGTCACCAGAGGAGG + Intronic
1026919483 7:74144684-74144706 GCCTCCCGAGTAATCCGAGCCGG + Intergenic
1031306259 7:120131057-120131079 TTCTCCCCAGTCACCCCAGCTGG - Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034493031 7:151404498-151404520 GCCTGCGGGGTCACCCTAGCGGG + Intronic
1036688692 8:10927900-10927922 GCCTCCTGGGTCACCCGCACAGG + Intronic
1040567022 8:48576480-48576502 GCCTCCCCAGGCACCAGATCGGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1052619316 9:30885148-30885170 GCCTTCCGAGTCTCCCAGGCTGG + Intergenic
1053412356 9:37923891-37923913 GCATCCCGAGCCAGCTGAGCCGG + Intronic
1056763289 9:89429239-89429261 GCATCCAGAGTCAGCCGAGGTGG - Intronic
1059443363 9:114323390-114323412 GCCTCCAGAGTCCCCTGGGCTGG - Intronic
1059444552 9:114330161-114330183 GCCTCCAGAGTCCCCTGGGCTGG - Intronic
1059453547 9:114386002-114386024 GCCTCCCAACCCACCCTAGCAGG - Intronic
1060370748 9:123068318-123068340 GTCTCCTGTGTCACCCGAGGTGG - Intronic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1187120312 X:16399361-16399383 GCCTCCCGAGTAGCTGGAGCTGG + Intergenic
1188906964 X:35801312-35801334 TCCTCCTGAGTCACCTGAGAAGG - Intronic
1190641000 X:52482690-52482712 GCCTCCCGAGTCACCCTCTGAGG + Intergenic
1190646672 X:52530175-52530197 GCCTCCCGAGTCACCCTCTGAGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic