ID: 1148447171

View in Genome Browser
Species Human (GRCh38)
Location 17:47744827-47744849
Sequence GGATACTGGTTGGGTAGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 2, 3: 7, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148447171_1148447180 10 Left 1148447171 17:47744827-47744849 CCTCTCCTACCCAACCAGTATCC 0: 1
1: 1
2: 2
3: 7
4: 202
Right 1148447180 17:47744860-47744882 CGCTTCTACCCCGACCTTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 185
1148447171_1148447185 21 Left 1148447171 17:47744827-47744849 CCTCTCCTACCCAACCAGTATCC 0: 1
1: 1
2: 2
3: 7
4: 202
Right 1148447185 17:47744871-47744893 CGACCTTCCTGGCCAGGCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1148447171_1148447187 27 Left 1148447171 17:47744827-47744849 CCTCTCCTACCCAACCAGTATCC 0: 1
1: 1
2: 2
3: 7
4: 202
Right 1148447187 17:47744877-47744899 TCCTGGCCAGGCGAAGGATGTGG 0: 1
1: 0
2: 1
3: 28
4: 183
1148447171_1148447181 15 Left 1148447171 17:47744827-47744849 CCTCTCCTACCCAACCAGTATCC 0: 1
1: 1
2: 2
3: 7
4: 202
Right 1148447181 17:47744865-47744887 CTACCCCGACCTTCCTGGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148447171 Original CRISPR GGATACTGGTTGGGTAGGAG AGG (reversed) Exonic
900518548 1:3094840-3094862 GGACTCTGGGTGGGAAGGAGGGG + Intronic
901161049 1:7177055-7177077 GGAGCCTTGGTGGGTAGGAGGGG - Intronic
901638138 1:10679888-10679910 GGATGCTGGAAGGGTAGGGGAGG - Intronic
902730204 1:18364082-18364104 GCAGACAGGCTGGGTAGGAGGGG - Intronic
903289392 1:22298277-22298299 GTATAAGGGTTGGGTGGGAGAGG - Intergenic
904256378 1:29257535-29257557 GGGTACTGGTGGAGTAGAAGTGG - Intronic
906138641 1:43519555-43519577 GGAGACTGGTGGGGAAGGAAGGG + Intergenic
907245197 1:53103903-53103925 GGATACTGGATGATTGGGAGGGG - Intronic
908334134 1:63102791-63102813 GGTGACTGGTGGAGTAGGAGTGG - Intergenic
908814148 1:68014247-68014269 GGGTGGTGGTTGGGTGGGAGAGG + Intergenic
910505046 1:87940940-87940962 GGATCCTGGTGGGGTAGAAAGGG + Intergenic
911084655 1:93966345-93966367 GGATAATGGTTGGGAGGGACAGG - Intergenic
912591382 1:110824403-110824425 GCACACTGGTGGGGTAGCAGTGG + Intergenic
913069254 1:115284644-115284666 GGAGACAGGATGGATAGGAGGGG + Intergenic
913460620 1:119082634-119082656 GGAGAGGGGTTGGGTGGGAGTGG - Intronic
914750601 1:150532463-150532485 AGATGCTGGTTGGGAGGGAGTGG + Intergenic
915599299 1:156912636-156912658 GGACAATGGGTGGGAAGGAGAGG - Intronic
916186412 1:162137947-162137969 GAATACTAGGTGGGTAAGAGGGG + Intronic
920553801 1:206889074-206889096 GTATGCTGGGTGGGTGGGAGGGG - Intergenic
922547295 1:226467384-226467406 GGAGAATGGATGGGAAGGAGGGG + Intergenic
922705508 1:227788279-227788301 GGGTCCTGGGTGGGTAGGGGCGG + Intergenic
923442282 1:234031983-234032005 GGAAAATGGATGGGTTGGAGGGG - Intronic
1062920836 10:1278420-1278442 GAATACTGGTGGGGAGGGAGGGG - Intronic
1063864591 10:10350448-10350470 TGATACTGATAGGCTAGGAGAGG - Intergenic
1065442014 10:25762598-25762620 TGATACTGGTGGGCTAGGGGAGG + Intergenic
1065818712 10:29506313-29506335 GGACACTGGCTGGGTACGTGGGG + Intronic
1065954208 10:30678083-30678105 GGACACTGGCTGGGTACGTGGGG - Intergenic
1070029754 10:72665559-72665581 GGTTACTGGTTGGGTAGGAGAGG + Intergenic
1070504817 10:77103818-77103840 GGGTAGTGGGTGGGCAGGAGGGG + Intronic
1070648235 10:78216168-78216190 GGATTGTTGTTGGGTAGGGGAGG + Intergenic
1072233814 10:93436250-93436272 GGATACTGATTGGGTCAGAATGG - Intronic
1074312170 10:112331356-112331378 TGATACTGGTGGGCTAGGGGAGG - Intergenic
1074434287 10:113420744-113420766 GGACCCTGCTTGGGTGGGAGAGG + Intergenic
1075143598 10:119863896-119863918 GTATCTTGGTTGGGTGGGAGGGG - Intronic
1076107502 10:127835081-127835103 GAGTACAGGTTGGGTGGGAGAGG - Intergenic
1076315232 10:129535140-129535162 GGCTGATGGTTGGGTTGGAGTGG + Intronic
1077744763 11:4890347-4890369 GCATAGTGGGTAGGTAGGAGAGG + Intronic
1078194904 11:9128319-9128341 GGAGACTTGTGGGGAAGGAGGGG + Intronic
1081721078 11:45288763-45288785 GGTGACTGGTTGGGTAGCAAAGG - Intergenic
1085016537 11:73177672-73177694 GGATCCTCACTGGGTAGGAGAGG - Intergenic
1086942040 11:92808536-92808558 GGATGCTTTTTGAGTAGGAGAGG + Intronic
1086951735 11:92897693-92897715 GGATCCTGGTTGGGTGGGGCAGG - Intergenic
1090902772 11:131047156-131047178 GGGTGGTGGGTGGGTAGGAGAGG + Intergenic
1091562249 12:1623743-1623765 GGATCCTGGTTTGGTGTGAGGGG - Intronic
1093024489 12:14233661-14233683 GGTTTCTGGATGGGTAGGATAGG - Intergenic
1093119053 12:15245315-15245337 GGAAATTGGCTGGGTAGGTGGGG - Intronic
1094362858 12:29649078-29649100 GGAGAGTGGTGGGGTTGGAGTGG - Intronic
1094773594 12:33695209-33695231 GGATAGTGGGGGGCTAGGAGAGG - Intergenic
1096646498 12:53040562-53040584 GGAACCTGGTTGGGCAGTAGGGG + Exonic
1101439020 12:104689238-104689260 GGTTTCAGGTTGGGTAGGAAGGG - Intronic
1101701935 12:107182224-107182246 GGATACTGGGTGATGAGGAGGGG - Intergenic
1102452497 12:113052402-113052424 GGACACTGGTGGGGTGCGAGTGG - Intergenic
1104311866 12:127660568-127660590 GGAAACTGGCTGGCTGGGAGGGG - Intergenic
1104837073 12:131798597-131798619 GGATACTGGAGGGGTGGGCGCGG + Intronic
1108275997 13:48810147-48810169 GGATGCTGTTTTGGCAGGAGAGG + Intergenic
1109986599 13:69994251-69994273 GAGGCCTGGTTGGGTAGGAGTGG + Intronic
1115318990 14:32057954-32057976 GCAGACAGGTTAGGTAGGAGAGG - Intergenic
1115950909 14:38720227-38720249 GGCTAATTGTTGGGTGGGAGAGG - Intergenic
1116313171 14:43352252-43352274 GAATATTGGTTGGGTTGGATTGG - Intergenic
1116366834 14:44077175-44077197 GGAATCTGGTTGGGCAGTAGGGG - Intergenic
1118319448 14:64744486-64744508 GGGTACTGGTGGGGGAGGTGGGG + Exonic
1119930654 14:78542943-78542965 TGAGACAGGGTGGGTAGGAGAGG + Intronic
1120303633 14:82739184-82739206 GTATAGTGGTTGGGTTGGATTGG + Intergenic
1122778617 14:104134281-104134303 GGAAACCGGCTGGGTAGGAATGG - Intergenic
1123893959 15:24809629-24809651 GCATACTGGATAGGTAGGGGAGG - Intergenic
1125065157 15:35474021-35474043 CAATATTGGTTGGGTTGGAGGGG + Intronic
1125475584 15:40046151-40046173 GGGTACTGCTTGAGAAGGAGAGG - Intergenic
1127332098 15:57949438-57949460 GGCTGCAGGTGGGGTAGGAGGGG + Intergenic
1129471841 15:75760397-75760419 GGAGAGTAGTTGTGTAGGAGTGG - Intergenic
1131083254 15:89554496-89554518 GAGTACTGCTGGGGTAGGAGGGG + Intergenic
1131122311 15:89830250-89830272 GGAAACTGAGTGGGCAGGAGAGG - Intergenic
1131561093 15:93440706-93440728 GGATACAAGTTAGGGAGGAGAGG + Intergenic
1132031507 15:98441844-98441866 CGGTACTGATTTGGTAGGAGAGG - Intronic
1132522902 16:399594-399616 AGATAATGGTTGGGGAGAAGTGG - Intronic
1133894296 16:9910951-9910973 TGATACTGGTTGTTTTGGAGAGG - Intronic
1134672296 16:16064713-16064735 AGATAATGGATGGGTGGGAGTGG - Intronic
1135261254 16:20982962-20982984 GGATTCTGGTGGGGTAAGTGGGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136580939 16:31150296-31150318 GGACACCTGTTGGGTGGGAGAGG + Intergenic
1137530745 16:49277343-49277365 GTCTCCTGGTTGGGAAGGAGAGG - Intergenic
1137624377 16:49898497-49898519 GGCTGCTGCTTGGGTAGAAGAGG - Intergenic
1140139950 16:72246036-72246058 GCATACTCATTGGGTAAGAGTGG + Intergenic
1140230954 16:73116701-73116723 GGACTCTGGTTGGCTAAGAGAGG + Intergenic
1141996322 16:87638556-87638578 GGACAAGGGTTAGGTAGGAGGGG + Intronic
1142146841 16:88496325-88496347 GGAGACAGGCTGGATAGGAGAGG + Intronic
1143706889 17:8704866-8704888 GGAAACTGGATGGATAGCAGAGG - Intergenic
1148447171 17:47744827-47744849 GGATACTGGTTGGGTAGGAGAGG - Exonic
1150680366 17:67279657-67279679 GGATGCTGAGTGGGGAGGAGGGG + Intergenic
1150733836 17:67718434-67718456 GGAGATTGGTTGGGCGGGAGAGG + Intronic
1152281579 17:79387800-79387822 GGGTATGGGTTGGGAAGGAGTGG - Intronic
1158910949 18:62061918-62061940 GGATAATGGTGGGGAAGTAGGGG - Intronic
1162164591 19:8743650-8743672 GGACACTGGCTTGGTAGCAGGGG + Intergenic
1162165663 19:8751118-8751140 GGACACTGGCTTGGTAGCAGGGG + Intergenic
1162166728 19:8758574-8758596 GGACACTGGCTTGGTAGCAGGGG + Intergenic
1162167794 19:8766030-8766052 GGACACTGGCTTGGTAGCAGGGG + Intergenic
1162168733 19:8772328-8772350 GGACACTGGCTTGGTAGCAGGGG + Intergenic
1162170479 19:8785092-8785114 GGACACTGGCTTGGTAGCAGGGG + Intergenic
1162315926 19:9937801-9937823 TGATACTGTTGGGCTAGGAGGGG + Intergenic
1163005259 19:14393450-14393472 GGAAGCTGGTTGGGCAGGGGAGG + Intronic
1163209798 19:15831897-15831919 GGTTTCTGGATGGGTAGGATAGG - Intergenic
1165663005 19:37598591-37598613 GGATACTGGTTAGAAAAGAGAGG - Intronic
1166149294 19:40860143-40860165 GGGCATTGGTTGGGAAGGAGAGG + Intronic
1166651345 19:44577543-44577565 AGATACCAGTTGGGAAGGAGGGG - Intergenic
1168427488 19:56250717-56250739 GGAAAGCCGTTGGGTAGGAGCGG - Intronic
926282477 2:11461275-11461297 GGGTATTGGTTGGGAAAGAGTGG - Intronic
926391689 2:12400323-12400345 TGATACTGTTTGGGTGGGTGGGG + Intergenic
927955898 2:27207205-27207227 GGACACGGGTTGGGGTGGAGAGG - Intronic
928490513 2:31778311-31778333 GCATGCTGGTTGGGGAGGAAAGG - Intergenic
929542023 2:42829920-42829942 GGAGACTTGGTGGGGAGGAGGGG - Intergenic
931526454 2:63160532-63160554 GGCCACTGTTTGGGTAGTAGGGG - Intronic
931707750 2:64961631-64961653 GGGTACTGATTGGGAAGGAGAGG + Intergenic
932715050 2:74094642-74094664 GGACACGGCTTGGGCAGGAGTGG + Intronic
934121541 2:88845073-88845095 GGTTAATGTTTGGGCAGGAGGGG + Intergenic
934141443 2:89051436-89051458 GGTTCCTGGATGGGTAGGATAGG - Intergenic
934227798 2:90149107-90149129 GGTTCCTGGATGGGTAGGATAGG + Intergenic
935025066 2:99268973-99268995 GTATTCTGGTTTGGTAGGTGAGG - Intronic
935200195 2:100849759-100849781 GGAGAGAGGTTGGGGAGGAGAGG + Intronic
935875259 2:107499382-107499404 AAATTCTGGTTGGCTAGGAGAGG - Intergenic
936058948 2:109282046-109282068 GGATGCTGGTGGGATATGAGTGG + Intronic
936791343 2:116157116-116157138 TGATACTGGTAGGCTAGGGGAGG + Intergenic
936963811 2:118105678-118105700 GGATACTTGCTTGGTAGGGGTGG + Intronic
937982099 2:127621964-127621986 AGATACTGGTGGGTGAGGAGGGG - Exonic
939171615 2:138702512-138702534 TGATAGTGGTTGGGTAGGGGTGG - Intronic
940424471 2:153514926-153514948 GGAAACAGGATGGGGAGGAGTGG - Intergenic
940582626 2:155601010-155601032 GGTTCCTGGTTGGGAAGGACTGG - Intergenic
942732131 2:179072211-179072233 GGAAACTGGTTTGCTTGGAGTGG - Intergenic
945118176 2:206429888-206429910 GGATGCTGGTAGGGAAGGGGAGG + Intergenic
945699784 2:213154793-213154815 GGAAAATGTTTGGGTAGGATGGG - Intergenic
1169497562 20:6129834-6129856 GGAGGCTGGATGGGAAGGAGAGG + Intergenic
1169975974 20:11328330-11328352 GGAAAGAGGTTGGGAAGGAGAGG + Intergenic
1171848908 20:30294319-30294341 GGGTTCTGGTTGGGAAGCAGAGG + Intergenic
1174368882 20:50073099-50073121 TGATACTGGTTGGGTAGGTGTGG - Intergenic
1175222457 20:57425326-57425348 GGATACTGGAGGGTCAGGAGGGG + Intergenic
1185328522 22:50239978-50240000 GGTTACTGGATGGGGAGGTGAGG + Intronic
950783377 3:15411603-15411625 GGTTTCTGTTTGGGTAGAAGAGG - Intronic
951594704 3:24305369-24305391 GGCTACAGGTTGGGTAGGGGTGG + Intronic
952752487 3:36836592-36836614 GGAAACTGGTTGTGAAGAAGAGG + Intronic
955767565 3:62360870-62360892 GCATACTGGTCTGGTAGGATGGG - Intergenic
958025421 3:88042934-88042956 GGATATTGATTGGGAAGGAATGG - Intergenic
960625473 3:119677661-119677683 CGATATTGGGTGGGGAGGAGCGG - Intergenic
969333812 4:6495089-6495111 GCAGGCTGGATGGGTAGGAGAGG - Intronic
971477452 4:27085637-27085659 GGATCCTCGTTGGGTGGGAACGG + Intergenic
978054687 4:104249097-104249119 GTATACTGGTGGGGGAGGAGAGG + Intergenic
980093908 4:128470204-128470226 GGATTCTGGGAGGGTAGGTGTGG + Intergenic
980700264 4:136417597-136417619 GGCCACTGTATGGGTAGGAGAGG + Intergenic
981156981 4:141449723-141449745 GGATAGTGGTTGGGGAGGAGTGG + Intergenic
982318955 4:154059360-154059382 GGTTTCTGGATGGGTAGGATAGG - Intergenic
987538815 5:19226177-19226199 GGATACTGGGCAGGTAGAAGTGG - Intergenic
987605772 5:20134212-20134234 GGAGGCTGGTTGGGGAGGGGTGG - Intronic
993519524 5:88883526-88883548 GGATACTGGGAGGGGAGGCGGGG + Intronic
993958061 5:94261745-94261767 GGAGACTGGCTGGGTGAGAGAGG - Intronic
995168829 5:109081937-109081959 GGATTCTGAAGGGGTAGGAGAGG - Intronic
997519152 5:134511527-134511549 GCATCCGGGTTGGGCAGGAGAGG - Intergenic
997979193 5:138458606-138458628 GGAAGCTCGTTGGGCAGGAGAGG - Intergenic
999329257 5:150661562-150661584 CGATCCTGGTTTGGGAGGAGAGG + Intronic
999373529 5:151070739-151070761 GGAAATTGGTTGGGGAGGACTGG - Intronic
999434297 5:151551177-151551199 GGATGATGGTTGGGTAAGTGGGG - Intronic
999581000 5:153037764-153037786 TGTCACTGGTTGGGAAGGAGTGG + Intergenic
1002979491 6:2121931-2121953 GCACACTGGTTGGTTAGCAGTGG - Intronic
1003939444 6:11009703-11009725 GGATACTGACTGAGTTGGAGAGG + Intronic
1004100585 6:12606174-12606196 GGACATGGGGTGGGTAGGAGCGG + Intergenic
1005225307 6:23635674-23635696 GGATACTAGTTGGTTACAAGTGG + Intergenic
1005685279 6:28247966-28247988 GGATAGGGGTGGGGTAGGACTGG + Intronic
1005938491 6:30543253-30543275 GGATACTGATCAGGAAGGAGTGG - Exonic
1006942903 6:37764770-37764792 GAGCACTGGATGGGTAGGAGTGG - Intergenic
1007321552 6:41031960-41031982 GGTTACTGGGAGGGAAGGAGAGG + Intronic
1007654685 6:43445107-43445129 GGATGCTGGGTGGTGAGGAGGGG - Exonic
1009043908 6:58214771-58214793 TGATATTGATTGGGTAGGTGGGG + Intergenic
1009219744 6:60969030-60969052 TGATATTGGTTGGGTAGGTGGGG + Intergenic
1011219292 6:85036888-85036910 GGGTCGTGGCTGGGTAGGAGGGG + Intergenic
1012909910 6:105106619-105106641 GGGTGCTGGTTAGGGAGGAGGGG + Intronic
1014041141 6:116827047-116827069 GGAAGGTGGGTGGGTAGGAGAGG + Intronic
1016904699 6:149137123-149137145 GGCTCCTGGTTGGGCAGCAGAGG - Intergenic
1017657709 6:156645776-156645798 GGATACTGGGTGGCTGGGATGGG + Intergenic
1017743332 6:157426246-157426268 GGATGCTGGGTGGGGAGGTGGGG + Intronic
1018964006 6:168469254-168469276 GGAAACCTGTTGGGAAGGAGCGG + Intronic
1019051704 6:169188496-169188518 GGAGACTGGCTGGATTGGAGGGG + Intergenic
1019959726 7:4449247-4449269 GGAGTCAGCTTGGGTAGGAGAGG - Intergenic
1020136326 7:5590117-5590139 GCAGTCTGGTTGGGTAGGACAGG + Intergenic
1023765355 7:43505276-43505298 GGATACAGGTAGTGGAGGAGAGG - Intronic
1024176583 7:46846473-46846495 GGATACTGGTTTGGTGGGATTGG + Intergenic
1027201008 7:76063836-76063858 GGTTACTGGTTAGGCCGGAGCGG + Intronic
1027979842 7:85203550-85203572 GGAAACTGTGTGGGTAGAAGAGG + Intergenic
1029959024 7:104669912-104669934 GGAACCTGGTTGGGCAGTAGGGG + Intronic
1030589137 7:111458654-111458676 GGATGCTGGTGGGATAGAAGAGG - Intronic
1031245305 7:119304169-119304191 GGGTAGGGGTTGGGTAGTAGTGG - Intergenic
1031986603 7:128167873-128167895 GGATAAAGGTGGGGTGGGAGTGG - Intergenic
1032497170 7:132371131-132371153 GGAGACGGGTTGGGGTGGAGAGG + Intronic
1034334275 7:150310436-150310458 GGTTTCTGGATGGGTAGGATAGG - Intronic
1036048309 8:5167953-5167975 GGATGCTGGTGGAGGAGGAGTGG - Intergenic
1036653697 8:10662123-10662145 GGACACTAGATGGGTAGGAAAGG - Intronic
1036656812 8:10682158-10682180 AGGTTCTGGTTGGGAAGGAGGGG - Intronic
1041011558 8:53548823-53548845 GGAAAGTGGGTGGGTGGGAGCGG - Intergenic
1041738323 8:61133961-61133983 TGAGAGTGGTTGGGTATGAGAGG + Intronic
1043721049 8:83547039-83547061 GGTTTCTGGATGGGTAGGATAGG - Intergenic
1043888333 8:85628246-85628268 GTATACTGGTAGGATAGTAGAGG - Intergenic
1044797847 8:95922237-95922259 GGAGACTGGTATGGTAGGAGTGG - Intergenic
1045388480 8:101692654-101692676 GCCTCCTGGGTGGGTAGGAGGGG - Intronic
1047739023 8:127792615-127792637 GGATGCTGGTGGGCTATGAGAGG - Intergenic
1048598007 8:135887125-135887147 GGATATTGTTTGGGTATGAAGGG + Intergenic
1053326071 9:37152803-37152825 GAATACTGTTTGGGAAGAAGGGG - Intronic
1053382462 9:37660149-37660171 GGATAGGGGCTGGGGAGGAGAGG + Intronic
1057747276 9:97762267-97762289 GGCTGCTGGGTGGGTATGAGAGG + Intergenic
1059060740 9:111033357-111033379 GGATACATTTTTGGTAGGAGAGG - Intronic
1188740778 X:33778065-33778087 GGACAGTGGTTGGAAAGGAGTGG + Intergenic
1191842838 X:65525174-65525196 GGGTGGTGGGTGGGTAGGAGTGG + Intronic
1196079816 X:111619316-111619338 GGAACCTGGTTGGGCAGTAGGGG - Intergenic
1196812531 X:119640142-119640164 GGATAGTGGGAGGGTGGGAGGGG - Intronic
1198177586 X:134172077-134172099 GTTGACTGGTTGGGTGGGAGGGG - Intergenic
1199767895 X:150953957-150953979 GGAGACTGGCTGGGGAGGAAGGG - Intergenic
1200129985 X:153836472-153836494 GGATACTGGTTATCTTGGAGTGG - Intergenic
1202073520 Y:21016433-21016455 GGTTACTGGGTGGAAAGGAGTGG - Intergenic
1202078220 Y:21058287-21058309 GGTTACTGGGTGGAAAGGAGTGG - Intergenic