ID: 1148449151

View in Genome Browser
Species Human (GRCh38)
Location 17:47763314-47763336
Sequence AGACAAATCCACAATTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148449151_1148449155 18 Left 1148449151 17:47763314-47763336 CCAATATAATTGTGGATTTGTCT No data
Right 1148449155 17:47763355-47763377 ATCAATTTTCCCCTCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148449151 Original CRISPR AGACAAATCCACAATTATAT TGG (reversed) Intergenic
No off target data available for this crispr