ID: 1148450528

View in Genome Browser
Species Human (GRCh38)
Location 17:47774848-47774870
Sequence GAGTCTAAAGGGCTGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148450528_1148450537 30 Left 1148450528 17:47774848-47774870 CCCTCCTTCAGCCCTTTAGACTC No data
Right 1148450537 17:47774901-47774923 AGCAAGTTCCCTCTTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148450528 Original CRISPR GAGTCTAAAGGGCTGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr