ID: 1148450845

View in Genome Browser
Species Human (GRCh38)
Location 17:47777132-47777154
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148450845_1148450854 -4 Left 1148450845 17:47777132-47777154 CCCTCCACCAGCCTCACCCACTG No data
Right 1148450854 17:47777151-47777173 ACTGGGCCCTCATAGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148450845 Original CRISPR CAGTGGGTGAGGCTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr