ID: 1148450886

View in Genome Browser
Species Human (GRCh38)
Location 17:47777278-47777300
Sequence AACTCTCTCCCAAAAACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148450886_1148450893 2 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450893 17:47777303-47777325 TAGTGGGATGGGAGTGAGGTGGG No data
1148450886_1148450892 1 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450892 17:47777302-47777324 TTAGTGGGATGGGAGTGAGGTGG No data
1148450886_1148450889 -10 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450889 17:47777291-47777313 GGAGAGAGTTGTTAGTGGGATGG No data
1148450886_1148450894 3 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450894 17:47777304-47777326 AGTGGGATGGGAGTGAGGTGGGG No data
1148450886_1148450895 9 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450895 17:47777310-47777332 ATGGGAGTGAGGTGGGGAGATGG No data
1148450886_1148450891 -2 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450891 17:47777299-47777321 TTGTTAGTGGGATGGGAGTGAGG No data
1148450886_1148450896 10 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450896 17:47777311-47777333 TGGGAGTGAGGTGGGGAGATGGG No data
1148450886_1148450890 -9 Left 1148450886 17:47777278-47777300 CCTCTGGTTTTTGGGAGAGAGTT No data
Right 1148450890 17:47777292-47777314 GAGAGAGTTGTTAGTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148450886 Original CRISPR AACTCTCTCCCAAAAACCAG AGG (reversed) Intergenic
No off target data available for this crispr