ID: 1148453193

View in Genome Browser
Species Human (GRCh38)
Location 17:47794383-47794405
Sequence CTCGATTTCCTCCCGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148453193_1148453197 11 Left 1148453193 17:47794383-47794405 CCTCCATCCGGGAGGAAATCGAG No data
Right 1148453197 17:47794417-47794439 TTACCTGCCAACCTTACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148453193 Original CRISPR CTCGATTTCCTCCCGGATGG AGG (reversed) Intergenic
No off target data available for this crispr