ID: 1148455513

View in Genome Browser
Species Human (GRCh38)
Location 17:47809064-47809086
Sequence CTGGAAACCCAGTAAGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148455513_1148455517 -6 Left 1148455513 17:47809064-47809086 CCCTCCACTTACTGGGTTTCCAG 0: 1
1: 0
2: 2
3: 25
4: 196
Right 1148455517 17:47809081-47809103 TTCCAGATGCACTGGCCACCTGG 0: 1
1: 0
2: 0
3: 15
4: 156
1148455513_1148455520 0 Left 1148455513 17:47809064-47809086 CCCTCCACTTACTGGGTTTCCAG 0: 1
1: 0
2: 2
3: 25
4: 196
Right 1148455520 17:47809087-47809109 ATGCACTGGCCACCTGGCGTGGG 0: 1
1: 0
2: 0
3: 14
4: 108
1148455513_1148455521 7 Left 1148455513 17:47809064-47809086 CCCTCCACTTACTGGGTTTCCAG 0: 1
1: 0
2: 2
3: 25
4: 196
Right 1148455521 17:47809094-47809116 GGCCACCTGGCGTGGGTCCCCGG 0: 1
1: 1
2: 2
3: 27
4: 194
1148455513_1148455519 -1 Left 1148455513 17:47809064-47809086 CCCTCCACTTACTGGGTTTCCAG 0: 1
1: 0
2: 2
3: 25
4: 196
Right 1148455519 17:47809086-47809108 GATGCACTGGCCACCTGGCGTGG 0: 1
1: 0
2: 2
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148455513 Original CRISPR CTGGAAACCCAGTAAGTGGA GGG (reversed) Exonic
903088167 1:20882830-20882852 CTGGAATCCCAGCAATTGGGAGG + Intronic
903330298 1:22593676-22593698 CGGGAAACCCCGTGAGTGCAGGG + Exonic
903543191 1:24108250-24108272 CTGGAAACCCTGTTTGAGGAGGG - Intronic
904784229 1:32973389-32973411 CTGGAAGCCCAGTGAGAGGCAGG - Intergenic
906195183 1:43925852-43925874 TGGGAAACCCAGTAAGATGAGGG + Intronic
907948951 1:59162317-59162339 ATAGAAAACCAGTAAGTTGAGGG - Intergenic
911513099 1:98831878-98831900 CTGGAATCCCAGCACTTGGAAGG - Intergenic
911876972 1:103178871-103178893 CTGGTAAACCAGTAAGAAGAAGG + Intergenic
912152522 1:106878079-106878101 CTGGACAAACAGTTAGTGGAGGG - Intergenic
912559098 1:110537548-110537570 CTGGAAAGCCAGCCAGTGGCTGG - Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
916686428 1:167151542-167151564 CTAGAAGCCCAGGAAGTGGGTGG - Intergenic
918757468 1:188356282-188356304 CTGCCAACCCAGTAAGGGGTGGG + Intergenic
922683564 1:227620993-227621015 CTGGAATCCCAGTATTTGGGAGG + Intronic
924415409 1:243851049-243851071 CTGGAAGCCCACGAAGTGGGCGG + Intronic
1064914088 10:20437244-20437266 GTGGATACCCAGTAATGGGATGG + Intergenic
1064916083 10:20460185-20460207 GTGGATACCCAGTAATGGGATGG + Intergenic
1065878150 10:30014950-30014972 CTGAAAACCCAGTCAGGGGCTGG + Exonic
1067061124 10:43078393-43078415 CTGGAAACTCAGTTTGTGCAGGG - Intronic
1069416890 10:68208625-68208647 CTGGAAACTCAGCCACTGGAGGG - Intronic
1070753564 10:78977781-78977803 CTGGAAACCCAGGGTCTGGAGGG - Intergenic
1071044610 10:81358949-81358971 CTGTAATCCCAGTACTTGGAAGG - Intergenic
1072475045 10:95751825-95751847 CTTGACACCCAGTAGGTGGATGG + Intronic
1073556313 10:104455752-104455774 GAGGAAAACCAGTAAGAGGATGG + Intergenic
1073637893 10:105218450-105218472 ATGGAAACTCTGTAAGAGGAGGG - Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1075810667 10:125222519-125222541 GTGGACTCCCAGTAAGTGGATGG + Intergenic
1075901250 10:126044177-126044199 CTGTAATCCCAGCAAGTGGGAGG + Intronic
1076212090 10:128657171-128657193 CCAGGAACCCAGTAAGTCGATGG + Intergenic
1079138322 11:17789124-17789146 CTGGAAGCCCAGTAAACTGAGGG - Intronic
1079735179 11:23988456-23988478 CTCTAAACCCAGGTAGTGGAAGG + Intergenic
1080247645 11:30197691-30197713 CTCAAAACCCAGTTAGTGCAGGG + Intergenic
1082729063 11:56772870-56772892 CTACAATGCCAGTAAGTGGAAGG + Intergenic
1083235972 11:61350862-61350884 CAGGAAACCAAGTAACTTGAGGG - Intronic
1084953563 11:72679672-72679694 CAGGTAACCCAGTGAGTGAAGGG + Intergenic
1088101029 11:106155852-106155874 CTGTAATCCCAGTTACTGGAGGG - Intergenic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1091257925 11:134207202-134207224 CTGAAAACCAAGTAAGTGGTAGG + Intronic
1096452630 12:51756742-51756764 CTGGAACCCCAGGAAGGGCACGG - Intronic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098086539 12:66850424-66850446 CTGAAAATACAGTAAGTTGATGG - Intergenic
1098389592 12:69955427-69955449 CTGGAAATAAAGTAAGTGCATGG + Intronic
1098604897 12:72378510-72378532 CTGGACAGCCAGTAAGTGAAGGG + Intronic
1101225798 12:102687089-102687111 ATGAAAGCACAGTAAGTGGATGG - Intergenic
1102066534 12:109980940-109980962 CAGGAAACCAGGTGAGTGGATGG - Exonic
1103359679 12:120346323-120346345 CTGGCAACCCAGAAAGAAGACGG + Intronic
1103435887 12:120925078-120925100 GTGGTACCCCAGGAAGTGGAAGG + Intergenic
1103746362 12:123127256-123127278 CTGGACTCCCAGGAAATGGAGGG - Intronic
1104590853 12:130083845-130083867 TAGGAAACCCAGTCAATGGATGG - Intergenic
1108013705 13:46051162-46051184 CTAAAAATCCAGCAAGTGGATGG - Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1109615383 13:64828064-64828086 CTGGAAACCCAGGGTCTGGAAGG - Intergenic
1110267689 13:73557086-73557108 GTGGAAACTCAGTAAATGAAAGG + Intergenic
1112370982 13:98793071-98793093 CTGGAAAGCCAGTAAGTGAGGGG + Intergenic
1115266097 14:31501822-31501844 CAGGAAATCCAATAAGTGGTGGG + Intronic
1115743073 14:36408605-36408627 CTAGAAAGCCACTAGGTGGAAGG + Intergenic
1115849723 14:37581367-37581389 CAAGAAACTCAGGAAGTGGAAGG + Intergenic
1116905341 14:50397783-50397805 CTGGAAACCCAGTACAAGGATGG + Intronic
1117257005 14:53988052-53988074 CTGTAATCCCAGTAAATGGGAGG - Intergenic
1118437821 14:65787501-65787523 CTTGAAAACCAGTATCTGGATGG - Intergenic
1122830943 14:104395419-104395441 CTGGAAACCCACTAAGAGGAAGG + Intergenic
1122902109 14:104786259-104786281 CTGGGAACCCACTGGGTGGAGGG - Intronic
1125989852 15:44095741-44095763 CTGGAAACCCACTAAGATAAAGG + Intronic
1126852419 15:52805476-52805498 CTGTAATCCCAGTAATTGTAGGG + Intergenic
1128213848 15:65920738-65920760 CTGGAAAGCCAGTCATTAGAAGG + Intronic
1129313369 15:74726867-74726889 CTGGAAACCCTGTAACAGGAAGG - Intergenic
1129363170 15:75037257-75037279 CTGGAAAACAGTTAAGTGGAAGG + Intronic
1129405102 15:75311933-75311955 CTGGGAACCTTATAAGTGGATGG + Intergenic
1129836892 15:78714343-78714365 CTGGGAACCTTATAAGTGGATGG + Intronic
1130584758 15:85172482-85172504 CTGGGAACCTTATAAGTGGATGG + Intergenic
1131204116 15:90427008-90427030 CTGTAATCCCAGTACTTGGAAGG + Intronic
1131259122 15:90879534-90879556 CTGGAGGCCAAGTAAGTGGGTGG + Exonic
1131580058 15:93634582-93634604 CTGGAAGCCCAGCCAGTGAAAGG - Intergenic
1132058896 15:98674421-98674443 CTGGAAAAGAAGTAACTGGAAGG - Intronic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1135516331 16:23138721-23138743 CAGCAAACCCTGTAAGTGCAAGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137500866 16:49010856-49010878 CTGGAAAGCAAGAAAATGGATGG + Intergenic
1137902873 16:52288044-52288066 CTGAAGACCCAGAAATTGGATGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1139579626 16:67864766-67864788 TTGAAAGCCCAGTAAGGGGAGGG - Intronic
1139603262 16:67999662-67999684 CTGTAATCCCAGTAATTTGAAGG + Intronic
1140601275 16:76477711-76477733 CAGGACACCCAGCTAGTGGAAGG + Intronic
1140653119 16:77110049-77110071 CTGAAAACCCACTCTGTGGAAGG + Intergenic
1141205979 16:81933462-81933484 CTGGAAACCCACTAACTAGAAGG - Intronic
1141549721 16:84797597-84797619 CTGGAATCCCAGTATGTTGGGGG + Intergenic
1141667457 16:85473297-85473319 GTGGAAACCAAGTTAGTGCAGGG + Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1143962677 17:10733647-10733669 CTGGAATCACAGCAAGGGGAGGG - Intergenic
1146909323 17:36638382-36638404 CTGGAAACATAGTAAGTGCTTGG + Intergenic
1147889130 17:43704740-43704762 CTGGGAACCCAGCAAGGGGTGGG - Intergenic
1148455513 17:47809064-47809086 CTGGAAACCCAGTAAGTGGAGGG - Exonic
1148578315 17:48726608-48726630 CTGGGTACCCAGTATGTGCAGGG - Exonic
1150220908 17:63495414-63495436 CTGGAAGCCCAGCAAGGGCAGGG + Intronic
1153181727 18:2442660-2442682 ATGGAAACCCAGACAGTGGGAGG - Intergenic
1157626016 18:49051800-49051822 TTGGGAACCCAGTCTGTGGAGGG - Intronic
1160024851 18:75208984-75209006 CTGGAAGTCCAGGAAGTGGCGGG + Exonic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1162658603 19:12151769-12151791 CTGGAATCCCAGAACTTGGAAGG - Intronic
1163198930 19:15748169-15748191 CTGGGGACCCAGTTATTGGAGGG - Intergenic
1164626731 19:29734269-29734291 CTGGAAACCCAGGGGGTGGCGGG - Intergenic
1165375255 19:35437360-35437382 CTGGATACACAGGAAGTAGAGGG - Intergenic
1166071011 19:40387956-40387978 CTGGAATCCCAGTTAGTTGGGGG - Intronic
1167771548 19:51523370-51523392 CTGGGATCCCAGAAAGGGGAAGG + Intronic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
930003080 2:46874356-46874378 CTGGAAGCCATGTAAATGGAGGG + Intergenic
931594367 2:63925484-63925506 CTGGAAACAAAGTATGTGAATGG - Intronic
932451221 2:71812006-71812028 CTGGGAATCCAGCAAGTGGAAGG + Intergenic
934653151 2:96103824-96103846 TTAGAAACCCAGTCAGTGGAGGG - Intergenic
936876890 2:117200897-117200919 CTGGAACCCCAGTTAGGGGCTGG - Intergenic
941026461 2:160461440-160461462 CTTTAATTCCAGTAAGTGGAGGG + Intronic
942083207 2:172421043-172421065 CTGGAAAGCAAGTCATTGGAAGG - Intergenic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
946976846 2:225162722-225162744 CAGGGAACCCAGTCAGTGGAAGG - Intergenic
947471439 2:230404717-230404739 CTGCAAACCCAGTAGGTTCAGGG - Intergenic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
1169087210 20:2834916-2834938 GTGGACACACAGTAAGTGGTTGG - Intergenic
1170779040 20:19407113-19407135 CTGGAAACTGAGTAAGAAGATGG + Intronic
1172009481 20:31838030-31838052 CTGGAACCCCAGTGGGAGGATGG + Intergenic
1172526527 20:35603104-35603126 CTGGAAGCCCAGAAACTGGTGGG - Intergenic
1172758782 20:37307498-37307520 CTGTAAACCCAGCACGTGGGAGG + Intronic
1177513228 21:22117136-22117158 CTGTAATCCCAGTACGTGGGAGG + Intergenic
1178581850 21:33844833-33844855 CTGGATACCAAGTCAGTGGAGGG - Intronic
1179454505 21:41489495-41489517 CTGGAAGTTCAGTAAGTGCAGGG - Exonic
1182351539 22:29702737-29702759 ATGGAAGCCCAGAGAGTGGAAGG - Intergenic
1184138189 22:42561823-42561845 CTGGAAACCCATCATGGGGAGGG + Intronic
1184370566 22:44079331-44079353 CTGGTAGGCCAGTAATTGGAGGG + Intronic
1184600045 22:45538069-45538091 CTGGAAGGACAGTAAGGGGACGG - Intronic
1184699515 22:46161165-46161187 CTCAAAACCTAGGAAGTGGATGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
950456768 3:13097369-13097391 CTGGAGACTCAGTGACTGGAGGG - Intergenic
952774848 3:37035389-37035411 GTGAACACCCAGTCAGTGGAGGG - Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
957842080 3:85685004-85685026 CTGTAATCCCAGCAAGAGGAGGG + Intronic
961064646 3:123864980-123865002 CAGGAAAGCCAGCAAGGGGAGGG - Intronic
962553570 3:136523074-136523096 ATAGATACCCAGTAAGGGGATGG + Intronic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
964716467 3:159727855-159727877 CTGGACACCCATTTAGAGGAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
965843666 3:172937030-172937052 CTGGAAACCCTGTAGGTTAAAGG - Intronic
967107624 3:186267120-186267142 GTGGAAACTCAGGAAGTAGAGGG + Intronic
969457506 4:7308491-7308513 CTAGAAACCCAGGAAGGGGATGG - Intronic
969728639 4:8940273-8940295 CTGGAAACCTTGTAGGAGGAAGG + Intergenic
969907812 4:10413655-10413677 CTGGAAAATTAGTGAGTGGATGG - Intergenic
970597391 4:17612922-17612944 AATGAAACCCAGTAAGGGGATGG - Intergenic
974707465 4:65539538-65539560 CTGGAAACCAAACAAGTGAAGGG + Intronic
975926031 4:79454820-79454842 CAGAAAAGCCAGTAAGTGGCTGG - Intergenic
981418598 4:144522468-144522490 CTGTAAACCCAGTAAATGGAAGG - Intergenic
984475424 4:180228880-180228902 TTGGAAACACAGTAAGATGAAGG - Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
990148436 5:52788519-52788541 CTGGAATGCCCGAAAGTGGATGG - Intronic
993110154 5:83646761-83646783 CTGGGAACCCAGTGAGTGCTGGG + Intronic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
996105907 5:119502933-119502955 CTGGATACCCAGTATTTGCAAGG + Intronic
996633866 5:125667233-125667255 CTTGCAACCCAGGAAGTGGTGGG - Intergenic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
1005665025 6:28044039-28044061 CTGAAATCCCAGCAACTGGAAGG + Intergenic
1007473830 6:42106618-42106640 TTGTAAACCCAGCAGGTGGATGG + Exonic
1011326609 6:86155432-86155454 CTGGGAACCCAAGGAGTGGAAGG + Intergenic
1014962873 6:127708285-127708307 CTGGAAACACAGTATGTGAAAGG + Exonic
1015177700 6:130328875-130328897 GTGGAAAGCAAGTAAGTGTAAGG + Intronic
1016473347 6:144398470-144398492 CTGGATAACCAATAATTGGAGGG - Intronic
1017525614 6:155239401-155239423 CTGGAAGCCCAGTGAGGGCAGGG - Intronic
1017602097 6:156094801-156094823 CTAGAAGCCCAGAGAGTGGAGGG - Intergenic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1021651894 7:22840680-22840702 CTGAGAACCCAGCATGTGGACGG - Intergenic
1021811469 7:24406065-24406087 ATGCAAACTCAGTAAGGGGAGGG - Intergenic
1023216923 7:37872304-37872326 TTGGAAACCCTGTAGTTGGAAGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1023907516 7:44532982-44533004 CTGTAATCCCAGTAATTGGGAGG + Intronic
1024180357 7:46886861-46886883 TTGGGAAGCCAGTGAGTGGAAGG + Intergenic
1024629890 7:51238336-51238358 CATGAGACCCAGTATGTGGAGGG - Intronic
1026217774 7:68364822-68364844 CTGGAATCTCAGTACTTGGAAGG - Intergenic
1026379513 7:69784893-69784915 CTGTAAACCCAGTACCTAGAAGG - Intronic
1028145383 7:87314910-87314932 CTGGTAAGCCACTAAGTGTAGGG + Intergenic
1029103649 7:98156207-98156229 CTGTAATCCCAGTACTTGGAAGG + Intronic
1032504724 7:132426321-132426343 CCGGCAACCCAGCCAGTGGAGGG - Intronic
1033020696 7:137721571-137721593 CTGGAAAGCAAGCAGGTGGAGGG - Intronic
1033883211 7:145913450-145913472 GTGGAAGCCAATTAAGTGGAAGG - Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1038184189 8:25258092-25258114 CTGGAAGCTCAGTGAGAGGAAGG - Intronic
1038732846 8:30142612-30142634 CTGTAATCCCAGTAACTGGGAGG - Intronic
1038948642 8:32389880-32389902 CTGTAACCCCAGTTATTGGAAGG - Intronic
1040901504 8:52421891-52421913 CCAGAAACCCAGGAAATGGAAGG + Intronic
1041416824 8:57619702-57619724 CTAGATAACTAGTAAGTGGATGG + Intergenic
1042849891 8:73206161-73206183 CTGCAATCCCAGCAAGAGGAGGG - Intergenic
1043940150 8:86188132-86188154 GTGGGAACACTGTAAGTGGAAGG - Intergenic
1045445232 8:102255685-102255707 CTGGAAACCCTATAAGTTGCAGG + Intronic
1045663198 8:104459463-104459485 TTGGAAACCCACTAAGTGCCAGG - Intronic
1045668093 8:104513276-104513298 GTGCAAAGCCAGTAAGTGGCAGG - Intronic
1045988476 8:108278072-108278094 CTGGATACCCAGTAGTAGGATGG - Intronic
1047556708 8:125939802-125939824 TTGGAAACCCAGTTATTGGATGG + Intergenic
1047783110 8:128125861-128125883 CTGCAAACCCATGAAGTGCAAGG - Intergenic
1048855714 8:138685196-138685218 ATGGAGAGCCGGTAAGTGGAAGG - Exonic
1049144732 8:140990884-140990906 CTGAAAACCCAGAGAATGGACGG + Intronic
1052233386 9:26182271-26182293 CTGTAATCCCAGTAAGTGCTTGG + Intergenic
1052646071 9:31235329-31235351 CTGTAATCCCAGTATGTGGAAGG + Intergenic
1052785073 9:32820707-32820729 CTGGGAGCCCAGTAAGTGGGAGG - Intergenic
1055190060 9:73508137-73508159 CTGTAATCCCAGTAACTGGGAGG + Intergenic
1056543219 9:87592236-87592258 GAGGAAACCCAGCAAGAGGAAGG + Intronic
1056686542 9:88768269-88768291 CTGGAATTCAAGTAAATGGATGG - Intergenic
1056793966 9:89644234-89644256 CTGGAAACCCATGAAGAAGAGGG - Intergenic
1058032124 9:100211594-100211616 ATGGAAACCAAGTTAGTGGATGG + Intronic
1058604028 9:106701807-106701829 CTGGAAACTCAGTAAGTACTTGG - Intergenic
1059999661 9:119946892-119946914 GTAGAAACCCAGTAAGTGAAAGG + Intergenic
1061302716 9:129714882-129714904 CTGGAAAGCCAGTCATTGCAGGG - Intronic
1061810174 9:133157808-133157830 CTGGAAACACTCTAAGTGGATGG - Intronic
1062000433 9:134213214-134213236 TAGGAAAACCAGAAAGTGGAAGG + Intergenic
1062583207 9:137237277-137237299 CTGGACACCTAGGAAGTTGAGGG + Intergenic
1185768006 X:2741547-2741569 CTGGAAACAGAGTATCTGGATGG - Intergenic
1186952813 X:14646216-14646238 CTGCATAGCCAGTAAGTGGCAGG + Intronic
1187166686 X:16810936-16810958 CTGGAAACCCAGCAATTTGGGGG - Intronic
1188308006 X:28582485-28582507 CTGGAAACCCACTATGTGCCAGG - Intergenic
1189234753 X:39478358-39478380 CTGTAAACACAGTAAATGTAAGG + Intergenic
1191861091 X:65667391-65667413 CTGGAAGGCCAGGACGTGGAAGG + Intronic
1192185198 X:68941938-68941960 CTGGAGATGCAGTAAGTGCAAGG + Intergenic
1192263068 X:69520129-69520151 GTGGAAGCCTAGAAAGTGGATGG - Intronic
1192466381 X:71359485-71359507 CTGTAATCCCAGTAATTGGGAGG + Intergenic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic