ID: 1148456237

View in Genome Browser
Species Human (GRCh38)
Location 17:47813054-47813076
Sequence CTGGGGGCTCACGCTTTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148456237_1148456244 -9 Left 1148456237 17:47813054-47813076 CCCCCTAAAGCGTGAGCCCCCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1148456244 17:47813068-47813090 AGCCCCCAGGTGGAACTCCTGGG 0: 1
1: 0
2: 3
3: 13
4: 148
1148456237_1148456243 -10 Left 1148456237 17:47813054-47813076 CCCCCTAAAGCGTGAGCCCCCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1148456243 17:47813067-47813089 GAGCCCCCAGGTGGAACTCCTGG 0: 1
1: 0
2: 3
3: 21
4: 174
1148456237_1148456253 18 Left 1148456237 17:47813054-47813076 CCCCCTAAAGCGTGAGCCCCCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1148456253 17:47813095-47813117 AATGGCTGGACCTCAGAACGTGG 0: 1
1: 0
2: 0
3: 26
4: 514
1148456237_1148456255 24 Left 1148456237 17:47813054-47813076 CCCCCTAAAGCGTGAGCCCCCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1148456255 17:47813101-47813123 TGGACCTCAGAACGTGGGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 117
1148456237_1148456249 0 Left 1148456237 17:47813054-47813076 CCCCCTAAAGCGTGAGCCCCCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1148456249 17:47813077-47813099 GTGGAACTCCTGGGATCCAATGG 0: 1
1: 0
2: 1
3: 40
4: 345
1148456237_1148456250 4 Left 1148456237 17:47813054-47813076 CCCCCTAAAGCGTGAGCCCCCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1148456250 17:47813081-47813103 AACTCCTGGGATCCAATGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
1148456237_1148456254 19 Left 1148456237 17:47813054-47813076 CCCCCTAAAGCGTGAGCCCCCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1148456254 17:47813096-47813118 ATGGCTGGACCTCAGAACGTGGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148456237 Original CRISPR CTGGGGGCTCACGCTTTAGG GGG (reversed) Intronic
900012491 1:128893-128915 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
900042555 1:484878-484900 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
900063994 1:719870-719892 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
908197016 1:61755049-61755071 CTGGGGGATTACACTTTGGGAGG + Intronic
911603044 1:99867793-99867815 GCGGTGGCTCACGCTTTGGGAGG - Intronic
922260925 1:223945377-223945399 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
922572645 1:226643045-226643067 CTGGGGGCTCACCTATGAGGAGG - Intronic
922736144 1:227980359-227980381 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
923145398 1:231194187-231194209 CAGGGGGCCCATGCTTTGGGTGG + Intronic
924342098 1:243047550-243047572 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
1062835952 10:635724-635746 CTGGGCGCTCAGGCTGGAGGTGG + Intronic
1064618656 10:17191796-17191818 GTGGGGAGTCACGCTTTGGGGGG - Intronic
1065348277 10:24770410-24770432 TTGGGGGCATAAGCTTTAGGAGG + Intergenic
1066734384 10:38457989-38458011 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
1069587053 10:69614070-69614092 CTGGGGGCTCAGGCATAGGGGGG + Intergenic
1069611475 10:69775466-69775488 ATGGGAGCTCATGCTTTTGGAGG + Intergenic
1070182200 10:74025355-74025377 GTGGTGGCTCACACTTTGGGAGG + Intronic
1070487155 10:76942227-76942249 ATGGTGGCTCACGCCTTGGGAGG - Intronic
1071337567 10:84613448-84613470 CAGGGGGCTCATGGTTTAGCAGG - Intergenic
1072524376 10:96258570-96258592 CAGGGGGCTCAAGCCTTATGTGG - Intronic
1076968827 11:121096-121118 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
1084369815 11:68733398-68733420 CTGGTGGCTCACACTTCAAGGGG - Intronic
1085284234 11:75349836-75349858 CTGGAGGCCCAGGCTTTGGGGGG - Intronic
1091479115 12:808376-808398 ATGGCGGCTCACACTTTGGGAGG - Intronic
1091830302 12:3544555-3544577 CAGGGGGCTCTGGCATTAGGCGG - Intronic
1096154073 12:49332171-49332193 TTGGGGCCTCACGCTGTAGGTGG - Intergenic
1102380623 12:112463335-112463357 GTGGTGGCTTACACTTTAGGAGG - Intronic
1102505742 12:113383689-113383711 ATGGTGGCTCACACTTTGGGAGG - Intronic
1104228915 12:126864819-126864841 CTGGGGGCTTATGCTTTTGTTGG - Intergenic
1104682295 12:130760325-130760347 CTGTGGGCTGAGGCTTTAGCAGG - Intergenic
1110711060 13:78651520-78651542 CTGGGGGCTCCCTGTTTATGGGG + Intronic
1111628209 13:90815668-90815690 CTGGGTGCTCCCGTTTTGGGGGG - Intergenic
1112326089 13:98443666-98443688 CTGGGGGCTCCCACTAGAGGTGG + Intronic
1113213436 13:108009681-108009703 CTGGGGGCTAAAGTTTTATGGGG - Intergenic
1122407337 14:101508405-101508427 CTGAGGGCTCAGGATTCAGGGGG - Intergenic
1127650228 15:60999668-60999690 CTGGGGGCTCAGCCTTCACGAGG + Intronic
1129308896 15:74690905-74690927 GTGGTGGCTCACGCCTCAGGTGG + Intronic
1129450505 15:75648603-75648625 TTGGCGGCTCTCGCTTTGGGAGG - Exonic
1129661355 15:77554722-77554744 CTGGGGGCTCAGGCTGAAGAGGG + Intergenic
1134373214 16:13645114-13645136 ATGGTGGCTCACACTTTGGGAGG - Intergenic
1138188382 16:54994700-54994722 CTGGGGGCACACACTGTTGGAGG + Intergenic
1138195889 16:55051867-55051889 CTGGGGGCTCATTCTTTCTGGGG - Intergenic
1138415428 16:56868689-56868711 ACGGTGGCTCACGCTTTGGGAGG + Intronic
1139760737 16:69182861-69182883 CTGGGGGCTCACGCCTCAGCTGG + Intronic
1142451849 16:90178025-90178047 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
1146380378 17:32323219-32323241 CTGTGGGCCCACGCCTTTGGCGG + Exonic
1148280781 17:46345519-46345541 ATGGTGGCTCACACTTTGGGAGG - Intronic
1148303009 17:46563454-46563476 ATGGTGGCTCACACTTTGGGAGG - Intronic
1148456237 17:47813054-47813076 CTGGGGGCTCACGCTTTAGGGGG - Intronic
1151955733 17:77379283-77379305 CTGGGGGCTCAGGCTCTCGGTGG - Intronic
1153545455 18:6200313-6200335 TTGTGGGCACACGCTGTAGGAGG + Intronic
1155085475 18:22453911-22453933 CTGGGGAGTCAGGATTTAGGGGG + Intergenic
1160645634 19:191024-191046 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
1161031325 19:2059089-2059111 GCGGTGGCTCACGCTTTGGGAGG - Intergenic
1165867352 19:38946882-38946904 CGGGGCCCTCACACTTTAGGAGG - Intronic
1167591660 19:50407405-50407427 CTGGGGCCTCACCCTTTGAGGGG - Exonic
1168078645 19:53993613-53993635 CTTGGGGCACAGGCTGTAGGCGG - Intronic
925619890 2:5781916-5781938 CTGCGGGCTCACGCCCTAGTGGG - Intergenic
925865181 2:8220904-8220926 ATGGTGGCTTACGCTTTGGGAGG + Intergenic
930762247 2:55049839-55049861 CTGGGGGCTCACGCTGGCCGGGG + Exonic
937974990 2:127577067-127577089 CCCGGGGCTTACGTTTTAGGGGG - Intronic
938416710 2:131109415-131109437 GTGGTGGCTCAAGCTTTTGGAGG + Intronic
939633264 2:144551020-144551042 GTGGGGGAGCAAGCTTTAGGAGG + Intergenic
939888578 2:147708242-147708264 CTTGGGGCTGACTCTTTAGGTGG + Intergenic
944969167 2:204971925-204971947 GTGGTGGCTCATGCTTTGGGAGG - Intronic
946154214 2:217796518-217796540 CTGGGTCCTCACGTTTCAGGTGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946837449 2:223786643-223786665 GTGGTGGCTCACACTTTGGGAGG + Intronic
948142641 2:235685143-235685165 CTGGGGACTCACGCCTTGTGAGG + Intronic
948370711 2:237487487-237487509 CTCGGGGCTTAGGCTTTGGGGGG + Intronic
949083280 2:242122595-242122617 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
1168819685 20:764472-764494 GTGGGGGCTCTCCCCTTAGGTGG - Intronic
1168819701 20:764511-764533 GTGGGGGCTCTCCCCTTAGGTGG - Intronic
1169488617 20:6053447-6053469 CTGGGGGCTCTGGCTTTTGTTGG - Intronic
1173262446 20:41448778-41448800 CTGTGGGCTCAAGTTGTAGGTGG + Intronic
1176230215 20:64028692-64028714 GTGGGGGCTCAGGCTTCAGACGG + Intronic
1176279871 20:64295199-64295221 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
1180574434 22:16759653-16759675 CTCGAGGCTCACGTTTCAGGTGG - Intergenic
1184669671 22:46006165-46006187 CTGGGGCTTCAGGCTCTAGGAGG - Intergenic
955010764 3:55012275-55012297 GTGGGCGCTCATGCTTTGGGTGG + Intronic
955900579 3:63749431-63749453 ATGGTGGCTCACACTTTGGGAGG - Intergenic
960964269 3:123093896-123093918 CTGGGGGCCCACTCCATAGGTGG - Intronic
961648391 3:128404885-128404907 CAGGGGACTCAGGCTTTAGATGG + Intronic
965305820 3:167061853-167061875 CTCAGGGCTCACGCTTTCTGAGG - Intergenic
968372047 3:198228502-198228524 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
968520548 4:1032942-1032964 CTGGGGGCTCGCGGTGTCGGGGG + Intergenic
969029938 4:4203834-4203856 CTGGCAGCTCAGGCTTTGGGTGG + Intronic
969624974 4:8297753-8297775 CCGGGGGATCACTCTCTAGGTGG - Intronic
969857958 4:10015114-10015136 CTAGGGGCTCAAGCATAAGGTGG - Intronic
970129957 4:12857605-12857627 GTGGTGGCTCACACTTTGGGAGG + Intergenic
971168838 4:24212685-24212707 CTGAGGGCTTACACATTAGGGGG - Intergenic
972155420 4:36155351-36155373 CAGTGGGCTCACACTTTAGCAGG + Intronic
974176880 4:58335782-58335804 CTGGGTGCTCATGTATTAGGTGG - Intergenic
977648630 4:99443320-99443342 CAGAGGGATCACGCTTTGGGTGG - Intergenic
979260734 4:118640984-118641006 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
981077737 4:140607663-140607685 CTTGGGCCTCAGGCTTTAGTGGG - Intergenic
990554117 5:56912880-56912902 TTGGGCGTTCACGCTTTAAGAGG + Intronic
996000914 5:118362454-118362476 CTGGGGGCTGTCGGTGTAGGGGG + Intergenic
997077453 5:130697310-130697332 CTGGGGGCACAGGCTTCAGGTGG - Intergenic
1002036296 5:176472623-176472645 ATGGTGGCTCATGCTTTGGGAGG + Intronic
1002731288 5:181334051-181334073 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
1002753247 6:140049-140071 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
1005086523 6:22013179-22013201 GTGGTGGCTCACACTTTGGGAGG + Intergenic
1010157091 6:72807768-72807790 GTGGAGGCGCACACTTTAGGAGG - Intronic
1014027863 6:116669831-116669853 ATGGTGGCTCACACTTTGGGAGG - Intergenic
1017267734 6:152469771-152469793 CTGGCGGCACACGCTCCAGGTGG - Intronic
1017718928 6:157231455-157231477 AGGTGGGCACACGCTTTAGGAGG + Intergenic
1020015963 7:4832074-4832096 CTGGGGGCTCACACTTCCCGGGG - Intronic
1023899094 7:44461295-44461317 CAAGGGGCTCACAGTTTAGGGGG - Intronic
1023974573 7:45018615-45018637 ATGGTGGCTCACGCCTTGGGAGG - Intronic
1024076434 7:45821230-45821252 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
1025127976 7:56360208-56360230 CTAGGAGTTCACGCTTTAGTTGG + Intergenic
1032090418 7:128908952-128908974 CTGGGGGCTCCCACATTGGGTGG + Intronic
1032267354 7:130378992-130379014 CAGGGAGCTCACGGTCTAGGCGG - Intergenic
1034552912 7:151832630-151832652 CGGGGGGCTCACGCTGTGGAAGG - Intronic
1035243913 7:157550237-157550259 GTGGGGGCTCAGGCTCCAGGAGG + Intronic
1035512221 8:200230-200252 CTAGGAGTTCACGCTTTAGTTGG + Intronic
1039424962 8:37478049-37478071 CTGGGGGCTCATTCTTTAGAAGG - Intergenic
1041154322 8:54969030-54969052 CTCAGGGCTCAAGCTTTAGTGGG - Intergenic
1055406503 9:75979339-75979361 CTAGGGCCTCATGCTTTAGAGGG + Intronic
1057234099 9:93345408-93345430 ATGGTGGCTCACACTTTGGGAGG - Intronic
1060885308 9:127148243-127148265 CTGGGGGCTCACAGCTTGGGAGG - Intronic
1061945945 9:133908220-133908242 CTTGGAGCTCATGCTTTAAGTGG - Intronic
1062253366 9:135609173-135609195 CTGGGGGCTCAGGGCTTGGGGGG - Intergenic
1062755693 9:138286556-138286578 CTAGGAGTTCACGCTTTAGTTGG - Intergenic
1203770409 EBV:47261-47283 TTGGGGACTCACACGTTAGGGGG + Intergenic
1187328846 X:18317174-18317196 ATGGTGGCTCACACTTTGGGAGG - Intronic
1190474570 X:50813937-50813959 CTGGGGCTTCACCCTTAAGGGGG - Exonic
1191753345 X:64567486-64567508 CTGAGGACTCAGGTTTTAGGAGG - Intergenic
1196680818 X:118467668-118467690 GTGGTGGCTCCCACTTTAGGAGG - Intergenic
1200134346 X:153867691-153867713 CTGGGGGGACACGGTTTGGGGGG - Intronic