ID: 1148462723

View in Genome Browser
Species Human (GRCh38)
Location 17:47847640-47847662
Sequence CTTTCCCGCAGCCCGGGATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148462719_1148462723 4 Left 1148462719 17:47847613-47847635 CCTTCAGGTGCGACGTCTTGGCG 0: 1
1: 0
2: 2
3: 1
4: 22
Right 1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG 0: 1
1: 0
2: 1
3: 12
4: 106
1148462717_1148462723 18 Left 1148462717 17:47847599-47847621 CCAGCGCAGGTGCGCCTTCAGGT 0: 3
1: 1
2: 3
3: 5
4: 136
Right 1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG 0: 1
1: 0
2: 1
3: 12
4: 106
1148462715_1148462723 26 Left 1148462715 17:47847591-47847613 CCGCTGTGCCAGCGCAGGTGCGC 0: 1
1: 3
2: 0
3: 10
4: 119
Right 1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG 0: 1
1: 0
2: 1
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148462723 Original CRISPR CTTTCCCGCAGCCCGGGATG TGG Exonic
900956013 1:5886897-5886919 CTTCCCTGCAGCCCGGGAGGAGG - Intronic
901132938 1:6973882-6973904 CCTTCCCACAGCCGGGGAAGGGG + Intronic
901934306 1:12617204-12617226 CTCTCCCGCCGCCGGTGATGAGG + Exonic
903129044 1:21266399-21266421 CTTCCCCCCAGCACAGGATGGGG - Intronic
903501092 1:23800555-23800577 GTTCCCCGCTGCCCGGGCTGGGG - Intronic
903648933 1:24911461-24911483 CTTTCCCCCACCCCGAGCTGCGG + Intronic
905448733 1:38044279-38044301 CTTTCCAGCCCGCCGGGATGCGG - Exonic
905910474 1:41649974-41649996 CTTTCCCACCCCCGGGGATGTGG - Intronic
907118064 1:51987059-51987081 CTTTCCCCCAGCCTGGGACAGGG - Intronic
921045758 1:211476922-211476944 CTTTCCGGGTGCCCTGGATGTGG - Exonic
921692209 1:218164742-218164764 CCTCCCCGCTGCCCGGGGTGCGG + Intergenic
924944713 1:248838471-248838493 CAGTCCCGCAGTCCGGGAGGCGG + Exonic
1062992664 10:1834850-1834872 GCTTCCCGCTGCCCGGGATGGGG + Intergenic
1073327114 10:102649510-102649532 CTTTCCCAGAGCCAGGGAGGAGG - Intronic
1077284026 11:1757999-1758021 CCCTCCCCCAGCCCTGGATGAGG + Intronic
1077499424 11:2902490-2902512 CCTCCCTGCATCCCGGGATGGGG + Exonic
1077762939 11:5123273-5123295 CTTTCCCAAAGCATGGGATGAGG + Intergenic
1082787656 11:57325622-57325644 CCTTCCCGCAGCCGGGGGAGTGG - Intergenic
1083696673 11:64448119-64448141 CGTTCCCACAGCGCGGGATCTGG + Intergenic
1084198584 11:67540704-67540726 ATTCCCAGCAGCCTGGGATGGGG - Intergenic
1092659267 12:10722108-10722130 CGTTCCCACAGTCCGGGAAGAGG + Intronic
1094830700 12:34298849-34298871 CTTTCCAGCAGCCCCGCATGGGG + Intergenic
1096692265 12:53328532-53328554 CCTTGCCGCAGCCAGGGATGTGG + Exonic
1096704348 12:53409401-53409423 CTTTCCCACAGCCTTGGATGTGG - Exonic
1101411646 12:104473661-104473683 CTCTCCCACAGCCCAGGAAGGGG - Intronic
1101828630 12:108240322-108240344 CCTTCCCGCAGCCAGAGGTGAGG - Exonic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1109376308 13:61498122-61498144 CTTTCTTTCAGCCTGGGATGAGG + Intergenic
1112315718 13:98360529-98360551 CTGTCCAGAAGCCAGGGATGGGG + Intronic
1112507395 13:99983069-99983091 CTTTGCCACAGCCCGGGAAGGGG - Exonic
1113639152 13:111944715-111944737 CCTGCCCGCATCCCTGGATGGGG + Intergenic
1113932151 13:113974209-113974231 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932179 13:113974303-113974325 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932207 13:113974397-113974419 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932221 13:113974444-113974466 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1117479888 14:56132116-56132138 CTTTACAGCAGCCCTGGAGGAGG + Intronic
1121008382 14:90504927-90504949 CCTTCCAGCAGCCCTGGGTGGGG + Intergenic
1124629293 15:31327719-31327741 CTTTCTCGCAGCCCGCGTAGTGG - Exonic
1126172184 15:45704353-45704375 CGTTCCTGGAGCCCGGGCTGCGG + Intergenic
1127477369 15:59347340-59347362 CTTTTCTGCAGCCTGGGGTGTGG - Intronic
1128720061 15:69941569-69941591 CTTTCCTGAAGCCCCAGATGCGG - Intergenic
1133247995 16:4461908-4461930 CTTTCCCGGTGCCCGGGACCTGG - Exonic
1133683951 16:8147946-8147968 ATTTCCTGCTGCCTGGGATGGGG - Intergenic
1134492217 16:14703627-14703649 CGTTCCCGCAGCCAGAGGTGGGG + Intergenic
1134497598 16:14742749-14742771 CGTTCCCGCAGCCAGAGGTGGGG + Intronic
1135139263 16:19907787-19907809 CTTTCCGCCTCCCCGGGATGAGG + Intergenic
1138450915 16:57092997-57093019 CTTCCCCGCAGTCCGGGAGCCGG - Intronic
1141674473 16:85510373-85510395 CTTCCCCGCAGCCCAGGACCAGG + Intergenic
1147217407 17:38908731-38908753 AGTTCCTGCAGCCCGGGCTGGGG - Intronic
1147745586 17:42692491-42692513 CTGTCCAGCATCCCGGGATGTGG + Exonic
1148332018 17:46818865-46818887 CCTTCCCGGAGCCCGAGTTGTGG - Intronic
1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG + Exonic
1150255614 17:63741890-63741912 CTTCCCCGCAGGGCGGGGTGGGG - Intronic
1151970449 17:77454905-77454927 CCTTCCCGCAGCCCCGGAGTCGG - Intronic
1152355383 17:79804303-79804325 CTTTCCGGCAGCCCCGGAACCGG - Intergenic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152422327 17:80200617-80200639 CTTTTCCACAGACCGGGTTGTGG + Intronic
1157681492 18:49610968-49610990 CTTTCCCAAAGCACAGGATGAGG - Intergenic
1158461298 18:57648462-57648484 CTTACCCCCAGGCTGGGATGCGG - Exonic
1158560789 18:58512052-58512074 CTTTCCCGCAGCCCTGAAATCGG + Intronic
1160187013 18:76683873-76683895 CTCACGTGCAGCCCGGGATGGGG - Intergenic
1160606830 18:80057938-80057960 TTTTCCCACAGACCGGGAAGGGG - Intronic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1162547580 19:11339671-11339693 CGTTCCCGGAGCGGGGGATGGGG + Intronic
1165141756 19:33704037-33704059 CTTGCCCTCAGGCCTGGATGAGG + Intronic
1165230085 19:34381335-34381357 CTTCCCCAGAGCCAGGGATGGGG - Intronic
1167497277 19:49827062-49827084 CTCTCCCACAGGCGGGGATGGGG - Intronic
1167937923 19:52922835-52922857 CTTTCCCTGAGCCCGCGTTGGGG - Intergenic
929857632 2:45650332-45650354 TTTTCCCGCAGCCCGGACGGCGG + Intergenic
937106489 2:119319827-119319849 CTGTCCCGCAGACCGTGAGGTGG + Intronic
938765323 2:134457361-134457383 CATTCCCACAGCCATGGATGAGG + Intronic
939370427 2:141292235-141292257 TTTTTCCACAGACCGGGATGGGG - Intronic
941906176 2:170717101-170717123 CCTTGCCGCAGCCCGGCACGTGG - Exonic
942278133 2:174337087-174337109 CCTTGCCGCAGCCCGGAATGTGG - Exonic
944609770 2:201390668-201390690 CTTCCCCCCAGTCAGGGATGAGG + Intronic
947482411 2:230512659-230512681 TTTTTCCACAGACCGGGATGGGG + Intronic
1172025906 20:31948345-31948367 CTTTCCTCCAGCCTGGCATGAGG + Intronic
1172073646 20:32277660-32277682 ATTCCCCGCTGCCCCGGATGGGG - Exonic
1174017733 20:47502197-47502219 CTTCCCCTCAGCCCGGGGGGCGG + Intronic
1175579629 20:60088412-60088434 CTCTCCCGTGGCCTGGGATGGGG + Intergenic
1175965512 20:62658283-62658305 CTCTCCCACAGGCCGGGATTTGG - Intronic
1175980279 20:62735296-62735318 TGTTCCCACAGCCAGGGATGTGG + Intronic
1185049160 22:48544728-48544750 CCTCCCCGCAGCCCGGAGTGGGG - Exonic
1185324796 22:50220344-50220366 CCTCCCCGCAGCCCGAGCTGGGG + Exonic
950345624 3:12288803-12288825 CTTTCCAGCCCCCCGGGGTGCGG - Intronic
959455896 3:106561519-106561541 CTTTGCAGCAGCCCAGGTTGGGG + Intergenic
960969088 3:123126337-123126359 CTCTCCCACAGCGGGGGATGGGG - Intronic
962708710 3:138068150-138068172 CTTCCTCGGGGCCCGGGATGAGG - Exonic
980375486 4:131941276-131941298 TTTTCCTGCAGCCCTGGGTGTGG - Intergenic
983238617 4:165207390-165207412 CTGGCCCGCAGGCCGGGACGCGG - Intronic
999076808 5:148804178-148804200 CTTTCCCCCTGCCATGGATGGGG - Intergenic
999770498 5:154771791-154771813 CTTTCCAGCAGGCCTGCATGTGG - Intronic
1001486684 5:172124588-172124610 CATTTCTACAGCCCGGGATGGGG + Intronic
1004900197 6:20186430-20186452 CTTTCCTGGAGCCCAGGGTGAGG + Intronic
1006271602 6:32970304-32970326 CCTTCCCCCAGCCAGGGATCAGG - Intronic
1006644478 6:35506320-35506342 CTTCCCCGCCTCCAGGGATGCGG - Intronic
1010043963 6:71420061-71420083 CTCACCCGCAGCCCGAGGTGCGG + Intergenic
1017978283 6:159376408-159376430 CTTTCACACAGCCAGGGCTGGGG - Intergenic
1019696916 7:2451343-2451365 CTGTCCCGCAGCCCTGGGAGTGG + Intergenic
1020184471 7:5948336-5948358 TTTTACAGCAGCCTGGGATGCGG - Exonic
1020298445 7:6776408-6776430 TTTTACAGCAGCCTGGGATGCGG + Exonic
1021451086 7:20784667-20784689 CCTTGCCGCAGCCCGGGATGTGG + Exonic
1024993575 7:55254732-55254754 CTTTCCCGCGCCCCGGGCAGAGG + Intronic
1032174510 7:129612167-129612189 CCTTCCCGCAGCTCGGGAGCGGG + Intronic
1032306015 7:130733421-130733443 CTTTGGTGCAGCCCGGGAAGGGG + Exonic
1034538406 7:151740178-151740200 CTAACCAGCAGCCCGGGAGGAGG - Intronic
1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG + Intronic
1037788979 8:21919949-21919971 CTTTCCCGCCTCCCGGGCCGGGG + Intronic
1043581538 8:81721184-81721206 GTCTCCCGCGGCCGGGGATGGGG + Intronic
1046788202 8:118291280-118291302 CTCTCCTGCAGGCCTGGATGGGG - Intronic
1048332430 8:133479886-133479908 CTTCCCTGCAGCCAGGGAAGGGG - Intronic
1062113115 9:134793165-134793187 CTTTCCCCCTTCCCGGGAAGGGG - Intronic
1186767903 X:12790567-12790589 CTTCCCCTCAGCCTGTGATGAGG + Intergenic
1190243554 X:48676378-48676400 CTTTCCCGGAGCCCGGGCTCTGG + Intergenic
1190286013 X:48961929-48961951 ATTTCCAGCAGCCAGGGAAGGGG + Exonic
1193575139 X:83186466-83186488 CCTCCTCGCAGCCTGGGATGGGG + Intergenic
1198533764 X:137567681-137567703 TCTTCCCGCAGCCCGGGAAGGGG - Exonic