ID: 1148463906

View in Genome Browser
Species Human (GRCh38)
Location 17:47853152-47853174
Sequence GGAGATGCCGCCTGACATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148463900_1148463906 10 Left 1148463900 17:47853119-47853141 CCAAGCTAGAGAAGTGACAGGTA 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1148463906 17:47853152-47853174 GGAGATGCCGCCTGACATCGGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1148463898_1148463906 13 Left 1148463898 17:47853116-47853138 CCACCAAGCTAGAGAAGTGACAG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1148463906 17:47853152-47853174 GGAGATGCCGCCTGACATCGGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148463906 Original CRISPR GGAGATGCCGCCTGACATCG GGG Intronic
902580535 1:17404898-17404920 GGAGAAGCCTCCTGAAGTCGGGG - Intergenic
923071141 1:230565455-230565477 GGATATGCTGCTTGACATCTTGG - Intergenic
923812189 1:237330946-237330968 GGAGATGCTGGCTAACACCGTGG + Exonic
1074766339 10:116702609-116702631 GGAGCAGCTGCCTGGCATCGGGG - Intronic
1076697262 10:132252949-132252971 GGAGAGGCTGCCGGACACCGTGG - Intronic
1083912874 11:65720349-65720371 GGCGGTGCCGCCTGGCCTCGTGG - Exonic
1090675210 11:128986019-128986041 GGAGCTGCTGGATGACATCGTGG + Exonic
1096475534 12:51907063-51907085 GGAGGGGCCGCCTGGAATCGGGG - Intronic
1102592886 12:113970381-113970403 GGAGATGAAGGCTGAGATCGGGG - Intergenic
1103701068 12:122848994-122849016 GGAGATGCTGCCTGCCTTTGAGG + Intronic
1114559323 14:23579004-23579026 GGAGATGCAGCCTGAGAGAGGGG + Intergenic
1120499528 14:85277751-85277773 GGAAATGCAGCCTGACCTAGTGG + Intergenic
1122221053 14:100239286-100239308 GGAGATGCCGGCCGAGATCGTGG + Exonic
1124896895 15:33785768-33785790 AGAGATGCCCCATGTCATCGAGG + Exonic
1125254156 15:37744051-37744073 GGAGAAGCTGCCTGGCATCCTGG - Intergenic
1129231477 15:74199474-74199496 GGAGATGCCGGCTGAGAGGGAGG - Intronic
1131264093 15:90905596-90905618 GGAGCTGCCGTTTGACAACGTGG + Exonic
1148463906 17:47853152-47853174 GGAGATGCCGCCTGACATCGGGG + Intronic
1151829944 17:76543620-76543642 GGGGAGGCCGCCTGCCATGGTGG - Intronic
1157486765 18:48093214-48093236 GGAGATGCCACCTGATGTGGTGG + Intronic
1157867227 18:51197303-51197325 GGAGCTGCCGCTGGGCATCGCGG + Exonic
1161306070 19:3569020-3569042 GAAGATGCAGGCAGACATCGGGG + Intronic
1165487290 19:36103505-36103527 GGAGATGCTGCGTGATATCCTGG - Exonic
1165743793 19:38218626-38218648 GGAGTTTCCGCATGACCTCGAGG - Exonic
1166643614 19:44514744-44514766 GGAGATGCGGCCAGGCATGGTGG - Intronic
931180289 2:59892637-59892659 GGTGATGTCTCCTGACAGCGTGG + Intergenic
935102123 2:100006895-100006917 GGAGAGGCCACCTGCCATGGCGG - Exonic
949026795 2:241770156-241770178 GGAGCCGCCGGCTGACCTCGGGG - Intergenic
1174746456 20:53068030-53068052 GGGGATGCCACCTGACAACACGG - Intronic
1176231556 20:64035762-64035784 GGACCTGCAGCCTGACATCCAGG - Intronic
1176385327 21:6136135-6136157 AGAGATGCTGCCTGAGAGCGGGG + Intergenic
1178730150 21:35094463-35094485 GCAGATGACTCCTGCCATCGTGG - Intronic
1179738146 21:43402117-43402139 AGAGATGCTGCCTGAGAGCGGGG - Intergenic
1179903013 21:44403424-44403446 GCAGCTGGCGCCTGACATTGAGG + Intronic
1185319706 22:50194908-50194930 GGAGGTGCAGCCTGACGTGGTGG + Exonic
953334996 3:42087186-42087208 GGAGGTGCCCACTGCCATCGGGG - Intronic
963035116 3:141019346-141019368 GGAGGTGCCGTCTGCCATCTGGG + Intergenic
981688988 4:147485397-147485419 GGAGATGGAGACTGACATAGAGG + Intronic
985041384 4:185894936-185894958 GGGGATGCCTCCTGACACCCCGG + Intronic
988549406 5:32186534-32186556 AGAGATGCTGCCTGACTTCAAGG - Intergenic
998379081 5:141711182-141711204 GGAGAGGCAGCCTGACATGGTGG + Intergenic
1000303738 5:159977440-159977462 GGAGATGGAGCCTGACACTGGGG - Intergenic
1017175988 6:151505266-151505288 TGAGATGCCGCCTGCCCTCTTGG - Intronic
1019175566 6:170157686-170157708 GGAGAGGCCGCCTGAGATGCTGG + Intergenic
1021332572 7:19356861-19356883 GAAAATGCCACCTGACATGGGGG - Intergenic
1026040106 7:66861177-66861199 GGAGATGACGCCTGAGAAGGAGG + Intergenic
1029364070 7:100106247-100106269 GGAGGTGCAGCCTGACATTGAGG - Exonic
1040328997 8:46376453-46376475 GGAGAAGCGGCGTGACAACGGGG + Intergenic
1048331796 8:133475695-133475717 TGAGATGCTGCCTGAGAGCGGGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1052603622 9:30671390-30671412 GGAGGAGCTGCCTGACATCATGG - Intergenic
1061462799 9:130753711-130753733 GGAGATGAGGCCTGGCATGGTGG - Intronic
1061743080 9:132721682-132721704 GAAGATGCCGCCAGCCATAGAGG - Intergenic
1197487626 X:127073978-127074000 GGAAATAAGGCCTGACATCGAGG + Intergenic
1198330731 X:135619987-135620009 GGAGAAGCAGCCGGACATCAAGG - Intergenic
1198336194 X:135669006-135669028 GGAGAGGCAGCCAGACATCAAGG + Intergenic
1200069756 X:153522398-153522420 GGAGATACCGGCTGGCCTCGTGG - Intronic