ID: 1148468142

View in Genome Browser
Species Human (GRCh38)
Location 17:47877266-47877288
Sequence CTGCCTGTCACCTCCTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148468142_1148468157 30 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468157 17:47877319-47877341 AGAGGGGCTGGGGATCCACCAGG No data
1148468142_1148468154 20 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468154 17:47877309-47877331 CCATGCCCTGAGAGGGGCTGGGG No data
1148468142_1148468145 -7 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468145 17:47877282-47877304 CAGGCAGGGTCTTCTCCTCATGG No data
1148468142_1148468152 19 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468152 17:47877308-47877330 GCCATGCCCTGAGAGGGGCTGGG No data
1148468142_1148468149 14 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468149 17:47877303-47877325 GGCCTGCCATGCCCTGAGAGGGG No data
1148468142_1148468151 18 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468151 17:47877307-47877329 TGCCATGCCCTGAGAGGGGCTGG No data
1148468142_1148468147 12 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468147 17:47877301-47877323 ATGGCCTGCCATGCCCTGAGAGG No data
1148468142_1148468148 13 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468148 17:47877302-47877324 TGGCCTGCCATGCCCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148468142 Original CRISPR CTGCCTGTCACCTCCTATCC TGG (reversed) Intergenic
No off target data available for this crispr