ID: 1148468151

View in Genome Browser
Species Human (GRCh38)
Location 17:47877307-47877329
Sequence TGCCATGCCCTGAGAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148468142_1148468151 18 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468151 17:47877307-47877329 TGCCATGCCCTGAGAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148468151 Original CRISPR TGCCATGCCCTGAGAGGGGC TGG Intergenic
No off target data available for this crispr