ID: 1148468157

View in Genome Browser
Species Human (GRCh38)
Location 17:47877319-47877341
Sequence AGAGGGGCTGGGGATCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148468150_1148468157 -9 Left 1148468150 17:47877305-47877327 CCTGCCATGCCCTGAGAGGGGCT No data
Right 1148468157 17:47877319-47877341 AGAGGGGCTGGGGATCCACCAGG No data
1148468142_1148468157 30 Left 1148468142 17:47877266-47877288 CCAGGATAGGAGGTGACAGGCAG No data
Right 1148468157 17:47877319-47877341 AGAGGGGCTGGGGATCCACCAGG No data
1148468146_1148468157 -1 Left 1148468146 17:47877297-47877319 CCTCATGGCCTGCCATGCCCTGA No data
Right 1148468157 17:47877319-47877341 AGAGGGGCTGGGGATCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148468157 Original CRISPR AGAGGGGCTGGGGATCCACC AGG Intergenic
No off target data available for this crispr