ID: 1148469770

View in Genome Browser
Species Human (GRCh38)
Location 17:47885663-47885685
Sequence GCTCCAGGAGTGGGCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148469758_1148469770 6 Left 1148469758 17:47885634-47885656 CCCCCTCTGCCACTAGCTTCTGA No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469756_1148469770 11 Left 1148469756 17:47885629-47885651 CCCTGCCCCCTCTGCCACTAGCT No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469763_1148469770 -3 Left 1148469763 17:47885643-47885665 CCACTAGCTTCTGACTCCAGGCT No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469752_1148469770 19 Left 1148469752 17:47885621-47885643 CCCCTGTCCCCTGCCCCCTCTGC No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469759_1148469770 5 Left 1148469759 17:47885635-47885657 CCCCTCTGCCACTAGCTTCTGAC No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469760_1148469770 4 Left 1148469760 17:47885636-47885658 CCCTCTGCCACTAGCTTCTGACT No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469754_1148469770 17 Left 1148469754 17:47885623-47885645 CCTGTCCCCTGCCCCCTCTGCCA No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469753_1148469770 18 Left 1148469753 17:47885622-47885644 CCCTGTCCCCTGCCCCCTCTGCC No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469755_1148469770 12 Left 1148469755 17:47885628-47885650 CCCCTGCCCCCTCTGCCACTAGC No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469757_1148469770 10 Left 1148469757 17:47885630-47885652 CCTGCCCCCTCTGCCACTAGCTT No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data
1148469761_1148469770 3 Left 1148469761 17:47885637-47885659 CCTCTGCCACTAGCTTCTGACTC No data
Right 1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148469770 Original CRISPR GCTCCAGGAGTGGGCCGGGC TGG Intergenic
No off target data available for this crispr