ID: 1148475056

View in Genome Browser
Species Human (GRCh38)
Location 17:47923137-47923159
Sequence TGCCAAAGATTGCCCCAGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148475051_1148475056 -6 Left 1148475051 17:47923120-47923142 CCGAAAAGAGCGTCCCCTGCCAA 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1148475056 17:47923137-47923159 TGCCAAAGATTGCCCCAGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 139
1148475050_1148475056 22 Left 1148475050 17:47923092-47923114 CCAGCAAAAAGCACTCAGCTGCA 0: 1
1: 0
2: 2
3: 20
4: 183
Right 1148475056 17:47923137-47923159 TGCCAAAGATTGCCCCAGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148475056 Original CRISPR TGCCAAAGATTGCCCCAGCC GGG Exonic
900658489 1:3771893-3771915 AGCAAGAGAGTGCCCCAGCCAGG - Intergenic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
907587427 1:55633662-55633684 TTTCCAGGATTGCCCCAGCCTGG + Intergenic
910945391 1:92586177-92586199 TGACAAAGATTACCTAAGCCAGG - Intronic
911507682 1:98773887-98773909 TGCAGAATATTGACCCAGCCGGG - Intergenic
915106060 1:153535833-153535855 CGCCACAGATGGCCCCAGTCTGG + Exonic
916271096 1:162942484-162942506 TGCAATAGATTCCCTCAGCCAGG - Intergenic
918394712 1:184101784-184101806 TGTGACAGATTGCCCCTGCCTGG + Intergenic
1063277375 10:4585106-4585128 TGCAAAAGATTTCCACAGACTGG + Intergenic
1065372730 10:25005730-25005752 TGCCAATTCTTCCCCCAGCCTGG + Intronic
1065493954 10:26310150-26310172 AGCCAAAGATAGCACCTGCCTGG - Intergenic
1068452998 10:57217063-57217085 TGACAAACATTACCTCAGCCAGG + Intergenic
1069283824 10:66688918-66688940 GAGCCAAGATTGCCCCAGCCTGG + Intronic
1069289769 10:66763882-66763904 TGCCAAAGGTTGGCCTAGTCCGG - Intronic
1069671790 10:70212028-70212050 TGACAAACACTGCCTCAGCCAGG - Intronic
1071118866 10:82255032-82255054 TGACAAACACTACCCCAGCCCGG + Intronic
1071488362 10:86118683-86118705 TGACAAACACTGCCTCAGCCAGG + Intronic
1072408022 10:95172966-95172988 TGCCTAAGCTTCCCCCAGCATGG + Intergenic
1075094408 10:119461386-119461408 AGCCAAACATTGCCCAGGCCTGG + Intergenic
1075823884 10:125337010-125337032 TGGCAAACACTACCCCAGCCAGG + Intergenic
1077027858 11:449646-449668 TGCGAAAGAATGACCCAGACCGG + Intronic
1078259932 11:9696003-9696025 TAACAACCATTGCCCCAGCCTGG - Intronic
1079995627 11:27292466-27292488 TGCCAGAAATTGCCTGAGCCAGG - Intergenic
1083019893 11:59496135-59496157 TGACAAAGACTACCTCAGCCGGG + Intergenic
1085534157 11:77208129-77208151 TGCCAGAGAATGTCCAAGCCAGG + Intronic
1087314689 11:96590222-96590244 GGCCAAGGAATGCCGCAGCCCGG + Intergenic
1088225539 11:107615954-107615976 TGACAAACACTGCCTCAGCCAGG - Intronic
1088249441 11:107850135-107850157 TGCCCAAGATTGCTCCATCCTGG + Intronic
1090482991 11:127084336-127084358 TGCCCAATATCCCCCCAGCCTGG - Intergenic
1092598220 12:10030685-10030707 CACCACAGATTGCCACAGCCGGG - Exonic
1094614089 12:32020820-32020842 TAACAAAGATTGGCCCAGCCTGG + Intergenic
1097103391 12:56605189-56605211 TGCCAAAGATGTGCCTAGCCTGG - Exonic
1097535524 12:60865305-60865327 TGCAAAATATTACCTCAGCCAGG - Intergenic
1097897390 12:64839087-64839109 TGACAAAGAGTGAACCAGCCAGG - Intronic
1098074218 12:66710055-66710077 TGGCAACCATTGCCTCAGCCAGG - Intronic
1104416800 12:128602449-128602471 TGCCCAAGATTGACCCAGGAGGG + Intronic
1105497204 13:20941178-20941200 TGCCAAATTTTGTTCCAGCCAGG + Intergenic
1106500559 13:30324518-30324540 ACCTAAAGATTGCCCCAGCCTGG + Intergenic
1107107682 13:36663991-36664013 TGCCAAACACTACCTCAGCCAGG + Intergenic
1114217470 14:20667610-20667632 TGGGAAAGATTGACACAGCCGGG + Intergenic
1118895412 14:69941577-69941599 TGCCAAAGATTTCCAAAGCTCGG + Intronic
1119227515 14:72955546-72955568 TGGCAAAGATTTCCCCAGAGCGG - Exonic
1120258791 14:82155884-82155906 TTCCAAAGATGGCCCCAGAAAGG - Intergenic
1120716077 14:87842048-87842070 TGACAAACATTACTCCAGCCAGG - Intronic
1122082089 14:99273414-99273436 TGACAAAGTTGGCCACAGCCTGG - Intergenic
1122218453 14:100219909-100219931 TGCAAGAGATCGCACCAGCCTGG - Intergenic
1125731591 15:41895284-41895306 TGCCAGACCTTGCCTCAGCCAGG + Intergenic
1127130738 15:55859874-55859896 TACCAAACATTTCCCCATCCTGG + Intronic
1128698954 15:69789959-69789981 TGCCAGGGAGTGGCCCAGCCAGG + Intergenic
1129285968 15:74525316-74525338 TGCCAAAAAATTCCCCAGCCTGG + Intergenic
1129696894 15:77745780-77745802 TGGCAAAGTTTGCCCGACCCTGG - Intronic
1130787465 15:87115780-87115802 TGGCAAACACTGTCCCAGCCAGG + Intergenic
1134078791 16:11310671-11310693 TGCCACAGATTTCCCGAGGCTGG - Intronic
1137789875 16:51165982-51166004 TTCAAAAGATTTTCCCAGCCAGG - Intergenic
1141161426 16:81631383-81631405 TTCCAAAGATAGCTCCAGCTGGG - Intronic
1142599495 17:1046685-1046707 TGTCAACGAATCCCCCAGCCCGG - Intronic
1142721005 17:1775822-1775844 TGCCAACGATTGGCCAAGCGTGG - Intronic
1148475056 17:47923137-47923159 TGCCAAAGATTGCCCCAGCCGGG + Exonic
1148920311 17:51025734-51025756 TGCCAAAAATTAGCCCAGCATGG + Intronic
1151209086 17:72530584-72530606 TGCCCCAGATAGCTCCAGCCAGG - Intergenic
1152239895 17:79155757-79155779 TCCCCAAGAGTGCCACAGCCTGG + Intronic
1152242257 17:79166716-79166738 TGCCAGGGCTGGCCCCAGCCAGG + Intronic
1157563055 18:48662135-48662157 TGTCAAAGATTGGCTCAGCCAGG - Intronic
1160473072 18:79156470-79156492 TGCCAAAGCTTCCGTCAGCCTGG + Intronic
1163390880 19:17028988-17029010 TGCCAAATATGCCCCCTGCCTGG + Intergenic
1163736227 19:18982675-18982697 TGTCTATTATTGCCCCAGCCCGG - Intergenic
1164581235 19:29436525-29436547 TGCCCAAGATGGCCCCAGACTGG + Intergenic
1164820747 19:31249384-31249406 TGCCAAGGACTGCAGCAGCCTGG - Intergenic
925154369 2:1638606-1638628 TGACACAGATTGCCCCTGCCTGG + Intronic
925545079 2:5006973-5006995 TGACAAACACTGCCTCAGCCAGG + Intergenic
929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG + Intronic
932321437 2:70825005-70825027 TGGCAAACACTACCCCAGCCTGG + Intergenic
933724460 2:85418743-85418765 ACGCAAAGATTGCGCCAGCCAGG + Intronic
934220899 2:90081758-90081780 TGCCCAAAAATGTCCCAGCCTGG - Intergenic
935504528 2:103883636-103883658 TTCCAGAGAAGGCCCCAGCCTGG - Intergenic
935831673 2:107006958-107006980 TGCAGAAGTTTGACCCAGCCTGG - Intergenic
939135068 2:138283975-138283997 GGCCACAGAGTGCCCAAGCCTGG + Intergenic
944003769 2:194876733-194876755 TACCAAAATTTGCCCAAGCCTGG + Intergenic
946507028 2:220312713-220312735 AGCAAAAGACAGCCCCAGCCTGG - Intergenic
946876270 2:224132826-224132848 TTCCAAGGTTTGCCCCAACCTGG - Intergenic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1169830312 20:9817879-9817901 TGCCAGAGATTGGCCATGCCTGG - Intronic
1169981275 20:11387286-11387308 TGACAAAGACTGCCTCAGCCAGG - Intergenic
1174986993 20:55466201-55466223 TGACAAACACTGCCTCAGCCTGG + Intergenic
1175146867 20:56903597-56903619 TCCCAGAGATGGCCCCAGGCAGG + Intergenic
1179526837 21:41984191-41984213 TGTCAAAGCTTGCAGCAGCCTGG + Intergenic
1181741400 22:24924489-24924511 GACCAAAGATTGCCCAAGTCTGG + Exonic
1183530512 22:38351033-38351055 TGCCAAAGATGGGAGCAGCCTGG + Intronic
1183811834 22:40264337-40264359 TTAGAAAGATTGCTCCAGCCAGG + Intronic
1184098350 22:42328787-42328809 TGCTAAAGCTTGCCCCAGACGGG + Intronic
1184579128 22:45401491-45401513 TGGCAAACATGGCGCCAGCCAGG + Intronic
949918583 3:8984256-8984278 TGCCAAGGACTGCCCCTCCCTGG + Exonic
954870724 3:53765633-53765655 TGACCAAGATGGCCCCAGGCTGG - Intronic
956231689 3:67023653-67023675 TGCCAAAGATCCCACAAGCCAGG - Intergenic
956232243 3:67030148-67030170 TGGCAAACACTGCCTCAGCCAGG - Intergenic
957139806 3:76338630-76338652 TGCCCCAGTATGCCCCAGCCTGG + Intronic
960996323 3:123342819-123342841 GGCCAGAGAACGCCCCAGCCAGG - Intronic
962320761 3:134388524-134388546 TGCCAGAGAGTGCCCGAGGCTGG - Intergenic
962837205 3:139199905-139199927 TAAGAAAGATTGCCCCAGCAAGG - Intronic
970045247 4:11845393-11845415 TGTTAAAGATATCCCCAGCCTGG + Intergenic
975464147 4:74690378-74690400 TGCAAAACATTGCCTCAGTCAGG - Intergenic
977859596 4:101940824-101940846 TGACAAACATTACCTCAGCCAGG - Intronic
979456123 4:120927813-120927835 TGCCAAAGAGAGCCCCCACCAGG + Intergenic
986218368 5:5743149-5743171 TGACAAACACTGCCCCAGCCAGG - Intergenic
990506909 5:56454447-56454469 TGCGCAATAGTGCCCCAGCCCGG + Intergenic
993060509 5:83032992-83033014 TGACAAACACTGCCCCAGCCAGG + Intergenic
995674814 5:114651550-114651572 AGCAAAGAATTGCCCCAGCCGGG - Intergenic
996125558 5:119722086-119722108 TACCAAAGATTGCCTCAGGAAGG - Intergenic
1001311498 5:170614169-170614191 TCCTAAATATTGCCGCAGCCAGG + Intronic
1001551275 5:172603818-172603840 TGGCAAAGAAAGCCCCAGCCTGG - Intergenic
1002435736 5:179229703-179229725 TTCCAAAGATATCCCCAGGCAGG + Intronic
1004005184 6:11631751-11631773 TGGCAAAGATTTCCCCAACCTGG - Intergenic
1004515677 6:16320615-16320637 TGCCCAGGATGGCCCCAGCTGGG - Intronic
1006967165 6:37999470-37999492 TGACAAACACTGCCTCAGCCAGG + Intronic
1007096886 6:39218771-39218793 TGCCAAAGGTGCCCCCAGCTAGG + Intronic
1007268114 6:40612413-40612435 CGACACAGATAGCCCCAGCCTGG - Intergenic
1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG + Intergenic
1008444386 6:51571265-51571287 GGCCCAATATTGCCCCAGCTGGG - Intergenic
1010990962 6:82479640-82479662 TGCCAGAGAATGTCCCAGACTGG + Intergenic
1011720272 6:90149057-90149079 TGCTAAGGGTTGCCCCAGCAGGG + Intronic
1012783525 6:103593083-103593105 TGACAAACATTGCCTCAGCCAGG - Intergenic
1019186470 6:170223435-170223457 TGCCAAAGCTGGACCCAGACTGG - Intergenic
1019921870 7:4168314-4168336 GGCCAAATGTGGCCCCAGCCCGG + Intronic
1021230667 7:18083193-18083215 TGACAAACATTACCTCAGCCAGG + Intergenic
1022990129 7:35698616-35698638 TACTAAAGATAGCCCCAGCTGGG + Intergenic
1023060866 7:36325184-36325206 TGGCACAGTCTGCCCCAGCCTGG + Exonic
1023533807 7:41187076-41187098 TTCCAAAGATGGCCACAACCTGG - Intergenic
1024058370 7:45680907-45680929 AGCCAAGGAATGCGCCAGCCTGG + Intronic
1026113984 7:67480922-67480944 TTCGAATGCTTGCCCCAGCCAGG - Intergenic
1026865259 7:73820196-73820218 TGGCAATCACTGCCCCAGCCAGG - Intronic
1028712222 7:93922102-93922124 TGCCAGAGCTAGCCCGAGCCCGG + Exonic
1032230605 7:130070617-130070639 CGCTAACGATTGCCGCAGCCCGG - Exonic
1032585948 7:133146452-133146474 TGACGAACATTGCCCCAGCCAGG - Intergenic
1033195342 7:139322539-139322561 TGGCTTAGATTGCCCCGGCCTGG - Intergenic
1039803303 8:40978350-40978372 TGCCGAAGATTGCAGCAGCTGGG + Intergenic
1040849518 8:51884636-51884658 TGCCAAGCATTGCACCAGGCCGG - Intronic
1041454766 8:58046611-58046633 TTTCAAAGGTTGCCCCAGCAAGG - Intronic
1042777776 8:72453168-72453190 TGCCAAAGAGTGCTCACGCCAGG + Intergenic
1044349132 8:91142816-91142838 TGACAGAGACTGCCCCAACCTGG - Intronic
1045656874 8:104396166-104396188 TGCCAAATATTTCCATAGCCTGG + Intronic
1048031475 8:130637457-130637479 TGCCAAATATTGCAACAGACTGG + Intergenic
1048045154 8:130766151-130766173 TACTAAATATTGCCCCAGCCAGG - Intergenic
1048436650 8:134424597-134424619 TGCCCAGGGTTGCCCCAGCTGGG + Intergenic
1049611036 8:143555456-143555478 TGCCCAACTCTGCCCCAGCCAGG + Intronic
1050953335 9:11625132-11625154 CTTCAAAGATTGCCTCAGCCTGG - Intergenic
1058717718 9:107737746-107737768 TGCCAATCCTTGCCCCACCCCGG - Intergenic
1059246526 9:112854338-112854360 AGCCAAAGATTTCCACAGCACGG - Intronic
1059686265 9:116639630-116639652 CATCAAAGACTGCCCCAGCCAGG - Intronic
1060889425 9:127178638-127178660 TCCCACAGTTTGCCACAGCCTGG - Intronic
1062172107 9:135140555-135140577 TTCCTCAGGTTGCCCCAGCCTGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1190724865 X:53182376-53182398 TGAAAAAGTTTGGCCCAGCCAGG - Intergenic
1195283635 X:103360935-103360957 TGGGAAACATTGCCCCAGCATGG + Intergenic
1197262564 X:124333872-124333894 TCCCAAAGAATGCCCCTCCCCGG + Intronic
1198031100 X:132754349-132754371 TGACAAATACTGCCTCAGCCAGG - Intronic
1198391480 X:136179456-136179478 TGCCTTAGATTGCCCCAGTAAGG - Intronic
1199708123 X:150448892-150448914 TGGCAAAGATTCCTCCAGCTCGG + Intronic