ID: 1148475785

View in Genome Browser
Species Human (GRCh38)
Location 17:47927859-47927881
Sequence CCCCCACCTGTGTCCTCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148475781_1148475785 -8 Left 1148475781 17:47927844-47927866 CCCTGAAGATGCAGTCCCCCACC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1148475785 17:47927859-47927881 CCCCCACCTGTGTCCTCCCTGGG 0: 1
1: 0
2: 2
3: 36
4: 377
1148475780_1148475785 9 Left 1148475780 17:47927827-47927849 CCAACTGCGGCGGGAGGCCCTGA 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1148475785 17:47927859-47927881 CCCCCACCTGTGTCCTCCCTGGG 0: 1
1: 0
2: 2
3: 36
4: 377
1148475782_1148475785 -9 Left 1148475782 17:47927845-47927867 CCTGAAGATGCAGTCCCCCACCT 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1148475785 17:47927859-47927881 CCCCCACCTGTGTCCTCCCTGGG 0: 1
1: 0
2: 2
3: 36
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148475785 Original CRISPR CCCCCACCTGTGTCCTCCCT GGG Exonic
900365907 1:2311897-2311919 CCCCCACCTCTGCCCTCCCCTGG - Intergenic
900391422 1:2435576-2435598 TTCCCACCTCTGTCCTCCCCAGG - Intronic
900672800 1:3866179-3866201 GCCCCACCTGAGTCCTTGCTGGG - Intronic
900790261 1:4675322-4675344 GCCCCACGCGTGTCTTCCCTTGG - Intronic
901456904 1:9368276-9368298 CTTCCACCTGTGCCCTCCCTGGG + Exonic
901628395 1:10636217-10636239 CACCCTCCTGCCTCCTCCCTCGG - Intergenic
901733494 1:11297315-11297337 CTTCCAGCTGTGTCCTCCCATGG - Intergenic
903220010 1:21864284-21864306 CTCCCTCCAGTGTCCTCCCAGGG + Intronic
903968105 1:27102211-27102233 CGCCCACCTGGGTCATCCCTAGG - Intronic
905403390 1:37718334-37718356 CCCCCACCGGAGTCCTGCCTTGG + Exonic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
905809135 1:40899238-40899260 CACCCACCTCTTGCCTCCCTTGG + Intergenic
905907086 1:41626353-41626375 CCTCTGCCTGTGTTCTCCCTGGG - Intronic
905954202 1:41978465-41978487 CCGCCTCCTGTGTCCTCCTGTGG - Intronic
906153676 1:43601965-43601987 GCCCTCCCTCTGTCCTCCCTGGG + Intronic
906169490 1:43712313-43712335 TCCCCACCTTTTTTCTCCCTTGG + Intronic
906667378 1:47631503-47631525 CCCGCCCCTCTGTCCTCCCCTGG + Intergenic
907021060 1:51067126-51067148 CCCCGAGCTGTGTGCACCCTAGG - Intergenic
907809221 1:57851937-57851959 TCCCCACCTCTTTGCTCCCTTGG + Intronic
907863114 1:58372675-58372697 CCCACACCAGGTTCCTCCCTCGG - Intronic
911043096 1:93607479-93607501 CTCATGCCTGTGTCCTCCCTGGG - Intronic
911161800 1:94688871-94688893 CCGCCTCCAGTCTCCTCCCTTGG + Intergenic
912579174 1:110704745-110704767 TCCCCACCTGTGTGCAGCCTAGG - Intergenic
913129343 1:115825720-115825742 CCCTCACCCCTGTCCTCCTTAGG - Intergenic
915898516 1:159829575-159829597 ACCCTACCTGTGTTCTCCCAGGG + Intronic
918177040 1:182056125-182056147 CACCCACCTGGGTGCTCTCTCGG + Exonic
920564225 1:206960791-206960813 ACCCCCTCTATGTCCTCCCTTGG + Exonic
921183147 1:212647054-212647076 CTCCCATCAGTGTCATCCCTGGG + Intergenic
921272969 1:213489300-213489322 AGCCCACCTGGGCCCTCCCTGGG - Intergenic
921303480 1:213772595-213772617 CCCCCACCAGTGTCCCCTCCCGG + Intergenic
922823489 1:228501293-228501315 CCCCCATGGGTTTCCTCCCTTGG - Intergenic
922862532 1:228831369-228831391 CCCCCACACGTGTCCTCCTCTGG + Intergenic
923081910 1:230665843-230665865 CTCCCAACTATGTCCTCACTTGG + Intronic
923444977 1:234062485-234062507 CTCCCAGCTGTCTCCTTCCTTGG + Intronic
923787687 1:237084013-237084035 GACCCACCTCTGTTCTCCCTGGG + Intronic
1062858881 10:794513-794535 CCGCCCCCTGGGTTCTCCCTTGG + Intergenic
1063300511 10:4845565-4845587 CCCCAGCCTATGTCCTCCCAGGG - Intronic
1063505027 10:6590010-6590032 CCCCCATCTCTGTCCCCCCAGGG + Intergenic
1064014724 10:11763152-11763174 CCGCCACCTGAGTCCCGCCTCGG - Intronic
1064250673 10:13704294-13704316 TCTCCACCTCTGGCCTCCCTGGG + Intronic
1064279931 10:13942304-13942326 CCCCTCCCTGTGTACTGCCTGGG + Intronic
1064613912 10:17133439-17133461 CACCCTCCTGTATCCTCTCTTGG + Intergenic
1065754896 10:28922201-28922223 CCACTCCCTGTGTCCTCTCTAGG + Intergenic
1065973786 10:30825233-30825255 CCACCCCCCATGTCCTCCCTAGG + Intronic
1066471790 10:35705468-35705490 CGCCCACCTGTGTGCTGCCCTGG + Intergenic
1067057567 10:43061253-43061275 CCCCCATCTCCGTCCTCACTGGG + Intergenic
1068519504 10:58063005-58063027 CCCCCTACTGTGTGCACCCTAGG - Intergenic
1070320518 10:75351551-75351573 ACCCCATCTGTATCTTCCCTGGG - Intergenic
1070497158 10:77035000-77035022 CCCTCCCCTCTGCCCTCCCTGGG + Intronic
1071984403 10:91036206-91036228 CTCCTACCTGTTTCCTCCCAAGG + Intergenic
1072221353 10:93330366-93330388 CCCCTACCTGTGCCCCTCCTAGG + Intronic
1073045878 10:100637942-100637964 CACCCCCCTGTGTCCTGCCCGGG + Intergenic
1073266607 10:102231488-102231510 ACCCCACCTGCCCCCTCCCTCGG - Intronic
1073515671 10:104073733-104073755 CCCCAAGCTGTGTCTTCACTTGG - Intronic
1074102939 10:110367916-110367938 CCCTGAGCTGTTTCCTCCCTCGG - Intergenic
1074286459 10:112102574-112102596 CCCCCACCTCTCTCCTCTTTGGG + Intergenic
1074311680 10:112327937-112327959 CCCCCACCCCATTCCTCCCTGGG - Intergenic
1074609035 10:115003805-115003827 ATCCCACCTGTGTGCTTCCTGGG - Intergenic
1074977794 10:118595328-118595350 CCATCGCCTGAGTCCTCCCTTGG + Intronic
1075004993 10:118823715-118823737 CATGCATCTGTGTCCTCCCTGGG - Intergenic
1075961327 10:126569526-126569548 ACCCCAACTGTGGCCTGCCTGGG - Intronic
1076618217 10:131770833-131770855 GCCCCACCTCTGTGCTCCCCTGG - Intergenic
1077114343 11:876543-876565 CAGCCACCAGTGTCTTCCCTGGG - Intronic
1077356354 11:2120674-2120696 CCCCCACCTTTCTCCTGCCGAGG - Intergenic
1077474797 11:2781311-2781333 CCCCTGTCTGTGTCCTCCTTGGG - Intronic
1079248884 11:18772992-18773014 CCCCCTCCTGTCTCATCCCACGG - Intronic
1080416481 11:32074076-32074098 ACCCCATCTGTGTTCTTCCTAGG - Intronic
1083608748 11:63994829-63994851 CCTCCACCTCTTTTCTCCCTCGG - Intronic
1083713255 11:64561391-64561413 GCCCCAGCTCTGTCCTTCCTGGG - Intronic
1084030144 11:66476309-66476331 CCCCCAACTGTGGCCCCCCAAGG + Exonic
1084354411 11:68627716-68627738 TCCCCACCTGTTACCTACCTCGG + Intergenic
1084461441 11:69298760-69298782 CCGCTTCCTGTGTCCTGCCTGGG + Intronic
1084689401 11:70716277-70716299 CCCCCTCCTGGGCCCTCTCTTGG - Intronic
1084937891 11:72596704-72596726 CCCCCACCTGGGTCCCGGCTCGG - Intronic
1085259563 11:75196504-75196526 CTCCCACCAGTGCCCACCCTGGG + Exonic
1085531024 11:77192042-77192064 TGCCCACAGGTGTCCTCCCTGGG + Exonic
1087837565 11:102890267-102890289 TCCCCACCTGTGTCCCTTCTGGG - Intergenic
1089070468 11:115695952-115695974 CCCCCACCAGTGTCTGTCCTTGG + Intergenic
1089226614 11:116928988-116929010 TCCCCACCTCTGACCTCCCAGGG - Intronic
1089357233 11:117861930-117861952 CAGCCAGATGTGTCCTCCCTGGG - Intronic
1089805851 11:121088135-121088157 TTCCCACCTGTGTCATCCATTGG + Exonic
1091930134 12:4389342-4389364 CCCCCACATGTCTCCTCTTTGGG + Intergenic
1091976542 12:4830423-4830445 AGCCCACCTGAGTCCTTCCTGGG + Intronic
1093158832 12:15720769-15720791 GCCCCAGCTGTGGACTCCCTGGG + Intronic
1094623820 12:32104744-32104766 GCCCCTCCTGTGTGCTCCCGTGG - Intergenic
1096550155 12:52366933-52366955 CCTCCAGCCCTGTCCTCCCTTGG - Intronic
1096876987 12:54637087-54637109 CTCCCACCTGTGTCTCCCATTGG - Intergenic
1097148300 12:56957074-56957096 CCACCTCCTGTCTGCTCCCTGGG - Intronic
1098882013 12:75926643-75926665 CCCCAACCTGGGACCTCCCCAGG + Intergenic
1100853660 12:98739406-98739428 CCCCCACCTGTCCCATCCATTGG - Intronic
1101788780 12:107910172-107910194 CCCCCGCCTGTGCCTTCCCTGGG + Intergenic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1104706808 12:130953831-130953853 CCCACTGCTGTGTCCTTCCTGGG - Intergenic
1104778321 12:131404162-131404184 GCCCCACCTGTGTCCTGGCTGGG - Intergenic
1106860683 13:33904412-33904434 TCCCAACATGTGTTCTCCCTTGG + Intronic
1107442605 13:40441464-40441486 CTTCCACCTGTGTCCTGCCCTGG - Intergenic
1107878854 13:44815654-44815676 TCCCCACCTGTGTCCCCCCTGGG + Intergenic
1113382736 13:109818489-109818511 CCCCCACCAGTGTCCAGCCCCGG - Intergenic
1113920842 13:113908439-113908461 CCCCCACCTTTCTTCTCTCTTGG + Intergenic
1114557137 14:23568464-23568486 CTCCCACCTCTGCCCTGCCTGGG + Exonic
1114663692 14:24366760-24366782 CCCTCCCCTCGGTCCTCCCTCGG - Intronic
1116356477 14:43937151-43937173 CCCCCTGCTGTGTCCAGCCTAGG - Intergenic
1118689371 14:68323390-68323412 CCCCCACTTGTGACCTCACTGGG + Intronic
1119478786 14:74947089-74947111 CCCTCAGCTGGTTCCTCCCTTGG + Intronic
1119712200 14:76830343-76830365 CCCACAGCTGTGTCCTCATTAGG - Intronic
1121313379 14:92946993-92947015 GCCTCCCCTGTGTCCTCCCTGGG - Intronic
1121720754 14:96107084-96107106 CCCCCACCCGTCACCTCTCTTGG - Intergenic
1122120224 14:99549341-99549363 CCCCCAGCAGTGACCTCCTTGGG + Intronic
1122151215 14:99727092-99727114 GCCCCTCCTCTGTGCTCCCTCGG + Exonic
1122267020 14:100551297-100551319 CCCCCTCCTGGGTTCTCTCTGGG + Intronic
1122577825 14:102752822-102752844 CCCTGCCCTGGGTCCTCCCTGGG + Intergenic
1122579769 14:102764252-102764274 CCCCTGCCTTGGTCCTCCCTGGG - Intergenic
1122797374 14:104212762-104212784 CCCACTCCTGGGTCCTCTCTCGG - Intergenic
1125793909 15:42390200-42390222 CCCCCACCTGGCACCTCCCAAGG + Intronic
1126221820 15:46223088-46223110 CACCCACCTTTTTCCTCTCTTGG + Intergenic
1128255080 15:66190465-66190487 CCTCCTCCTGTTTCCTTCCTTGG - Intronic
1128264330 15:66253803-66253825 CCCCCACCCGCTTCGTCCCTCGG + Intergenic
1128332308 15:66763641-66763663 CCCTCACCTCTGTCCTCTCCAGG + Intronic
1128357342 15:66937346-66937368 TCACCACCTGTGTCTTCCCAGGG - Intergenic
1129034927 15:72643089-72643111 GCCCCACTTCTGTCTTCCCTTGG + Intergenic
1129183065 15:73889047-73889069 CTCCCACCTGCCTCCTCCCTAGG + Exonic
1129214955 15:74094127-74094149 GCCCCACTTCTGTCTTCCCTTGG - Intergenic
1129221476 15:74134057-74134079 CCCTCACTTGTGTCCTCCTCCGG - Exonic
1129880839 15:79005179-79005201 CCCCCACCTCAGGCCTCACTGGG - Intronic
1129911245 15:79228426-79228448 TCCACACCTGTCTCCTCTCTCGG - Intergenic
1131066052 15:89435704-89435726 CCCCTGCCTGTGGCCTGCCTGGG + Intergenic
1131108800 15:89751419-89751441 GCCCCACCTGGGCCCTCGCTTGG + Intergenic
1131366653 15:91847227-91847249 CTTCCACCTGTGTCCTTCCATGG + Intergenic
1131741552 15:95398436-95398458 CTTCCCCCTGTGTCCTCACTTGG + Intergenic
1132167204 15:99605724-99605746 CACCCACCTTTGGCCTCCCAAGG - Intronic
1132221277 15:100107432-100107454 CCCTCAACTGTGTCCTCCACAGG - Intronic
1132500970 16:284578-284600 CCCTCACCTGTGTACTCCTCCGG - Exonic
1132715184 16:1286553-1286575 CCTCCCCATGTGTCCCCCCTAGG + Intergenic
1132872858 16:2123397-2123419 CCCACACCTGAGTCCTGCCCAGG - Intronic
1133115295 16:3575176-3575198 CCCCCTCCTCTGTCCTTCTTAGG - Intronic
1133316814 16:4890048-4890070 GCCACAGCTGTGTCCTCCCTGGG - Intronic
1134551946 16:15142576-15142598 CCCACACCTGAGTCCTGCCCAGG - Intergenic
1134660620 16:15981594-15981616 CCCCCTGCTGTGTGCTGCCTAGG - Intronic
1135052881 16:19206709-19206731 CCTCCACCTCTGTCCTCACCTGG + Intronic
1135609733 16:23855880-23855902 CTCACAGCTGTGTCCTCCCTGGG - Intronic
1135731436 16:24898106-24898128 CCCCCAGCTGTGTTCTCACCTGG - Exonic
1136267394 16:29129777-29129799 CCCTCACCTGTGTGGGCCCTTGG + Intergenic
1136296700 16:29308053-29308075 CCACCACCTCTGTCCTCCCCAGG - Intergenic
1136707465 16:32201709-32201731 CTCCCACCAGTGCCTTCCCTTGG - Intergenic
1136718040 16:32300986-32301008 GCCCCACCTGTGCCCTGCCATGG - Intergenic
1136760446 16:32727708-32727730 CTCCCACCAGTGCCTTCCCTTGG + Intergenic
1136807657 16:33142678-33142700 CTCCCACCAGTGCCTTCCCTTGG - Intergenic
1136836416 16:33507256-33507278 GCCCCACCTGTGCCCTGCCATGG - Intergenic
1139207398 16:65042673-65042695 CCCCCACTTCACTCCTCCCTTGG + Intronic
1139963961 16:70735158-70735180 CATCCCCCAGTGTCCTCCCTGGG - Intronic
1140196863 16:72862245-72862267 CACCCACCTCAGCCCTCCCTAGG + Intronic
1141303527 16:82839538-82839560 CCCAGCCCTGTCTCCTCCCTTGG + Intronic
1142058323 16:88014364-88014386 CCACCACCTCCGTCCTCCCCAGG - Intronic
1142070686 16:88090100-88090122 CCCTCACCTGTGTGGGCCCTTGG + Intronic
1142134903 16:88447334-88447356 CCCCCATCTCTGTCCACCTTGGG - Intergenic
1203008388 16_KI270728v1_random:216779-216801 GCCCCACCTGTGCCCTGCCATGG + Intergenic
1203062599 16_KI270728v1_random:988023-988045 CTCCCACCAGTGCCTTCCCTTGG + Intergenic
1142523319 17:519976-519998 CCCGCTCCTGTCTCCTCCCGTGG - Intronic
1142608889 17:1096981-1097003 TCCCCAGCTGTCTCCTCCCGGGG - Intronic
1143855364 17:9844170-9844192 CCTCCACCTGTGTCCTCCTCAGG - Intronic
1144640711 17:16935156-16935178 CCCCAACCTCAGCCCTCCCTAGG + Intronic
1145255288 17:21318849-21318871 CTCCCTGCTGTGTCCTCCCATGG - Intergenic
1145321323 17:21769106-21769128 CTCCCTGCTGTGTCCTCCCATGG + Intergenic
1147418800 17:40311804-40311826 CCCCCACCCCTGTCCCACCTGGG - Intronic
1147553997 17:41464752-41464774 TCCCCACCTGTGTTCATCCTGGG + Intronic
1147650241 17:42057972-42057994 CCCCCATCTGTCTCCTGCCCAGG - Intronic
1148142171 17:45336757-45336779 CCTCCACATGGATCCTCCCTTGG + Intergenic
1148475785 17:47927859-47927881 CCCCCACCTGTGTCCTCCCTGGG + Exonic
1149896373 17:60431658-60431680 TCCCCACCTGTGTGCTCCACTGG - Intergenic
1150610038 17:66726549-66726571 CTCCCACCTGTCTCCTGCCTTGG - Intronic
1151235994 17:72720140-72720162 CTCTCTCCTGTGTCCTCCCTGGG - Intronic
1151576198 17:74953651-74953673 CTCCCACCTGTGCCCTGCCCAGG - Exonic
1151983557 17:77528304-77528326 TCCCCACCTGCCTCCTCCCAGGG - Intergenic
1152089956 17:78240772-78240794 CCCCCAGATTTGTCCTCACTGGG - Exonic
1152223169 17:79080417-79080439 CCTCCACCTCTTTCCTGCCTTGG + Intronic
1152576638 17:81144061-81144083 CCCCCACCCCTGTCCCCGCTCGG + Intronic
1153967018 18:10191285-10191307 CTCCTCCCTGTGTCCTCCCATGG - Intergenic
1154210877 18:12377452-12377474 CGCCCTCCCGAGTCCTCCCTCGG - Intergenic
1154385191 18:13886786-13886808 CTCCCAAATTTGTCCTCCCTAGG - Intronic
1156557952 18:38088608-38088630 CCCCAACCTCTCTTCTCCCTGGG - Intergenic
1160709692 19:545280-545302 CCCCCACCGGCTTCCTCCCTTGG - Intronic
1160768120 19:817639-817661 CCCTGACCTGTGCCCTCCCCAGG - Intronic
1161014767 19:1978213-1978235 CCCCCTCCTGCCTCCTGCCTCGG + Intronic
1161338248 19:3726177-3726199 CCTCCACCTGTCCCCTGCCTGGG + Intronic
1161852717 19:6746035-6746057 CCCCCACCCCTCTCCCCCCTGGG + Intronic
1161955285 19:7490719-7490741 CCGCCACTTGTGTGCTCTCTGGG + Intronic
1162301371 19:9846984-9847006 TCCCTTCCAGTGTCCTCCCTAGG - Intronic
1162454722 19:10776433-10776455 GCCACAGCTGTGCCCTCCCTGGG - Intronic
1162858378 19:13487298-13487320 CCCCCACCTGTTTCCCCCTCTGG - Intronic
1163162377 19:15472226-15472248 ACCCCACATTGGTCCTCCCTGGG + Intronic
1163218673 19:15898762-15898784 TGCCCTCCTGTGACCTCCCTTGG - Intergenic
1163365353 19:16873067-16873089 CCGCACTCTGTGTCCTCCCTGGG + Intronic
1163756553 19:19109912-19109934 CCCCGACCTGCGCCCTCCCTGGG - Intronic
1163774846 19:19212049-19212071 CCCCCACCTGGCTCCTAGCTCGG - Exonic
1164712694 19:30368791-30368813 CCTCCACCAGTCCCCTCCCTTGG - Intronic
1166083704 19:40461252-40461274 CCCTTTCCTGGGTCCTCCCTGGG + Intronic
1166306748 19:41939906-41939928 CCCCCACCTCTAACCTCCCTCGG + Intergenic
1166689270 19:44813018-44813040 CCCCCAGCTCTCTCCTTCCTAGG - Intronic
1167040503 19:47020479-47020501 CCCCATCCTGTGTCCTGCCCAGG - Intronic
1167104437 19:47421903-47421925 CCCCCCACCGTATCCTCCCTGGG + Intergenic
1167477939 19:49711778-49711800 CCATGACCTGTGACCTCCCTGGG + Intronic
1167707668 19:51091184-51091206 CCCCCGTCTCTGTCTTCCCTTGG + Intergenic
1167880576 19:52454032-52454054 CCCCCAACCTTGTCCTCCTTGGG + Intronic
925356312 2:3243989-3244011 GGCTCACCTGTGTCCTCTCTCGG + Intronic
926006891 2:9379395-9379417 CCCCCACCTGAGGCCACACTTGG + Intronic
926514195 2:13820880-13820902 CCCCAACCCCTGCCCTCCCTAGG + Intergenic
928102789 2:28449260-28449282 CCCTTACCAGTGTCCTGCCTGGG - Intergenic
930079324 2:47433613-47433635 CCCCCACCTCTCTCCTGGCTGGG + Intronic
934065197 2:88333918-88333940 CACCCAAGTCTGTCCTCCCTAGG - Intergenic
934989966 2:98914138-98914160 CCCCTACCTGGCTCCTGCCTCGG - Intronic
937091930 2:119212287-119212309 CCCCCACCTCTGTCCTGCCTGGG + Intergenic
937115101 2:119399316-119399338 CCCCCATCTCTGTCCATCCTGGG + Intergenic
937295117 2:120805406-120805428 CCTGCCCCTGTGTGCTCCCTGGG + Intronic
937413295 2:121695076-121695098 TCCCCAGCTCTGTCATCCCTAGG - Intergenic
937992213 2:127670832-127670854 CCCCCACCAGACTCCTCGCTGGG + Intronic
938381585 2:130839223-130839245 CCACAACCTGTGTCCTCACGGGG - Intronic
940801689 2:158139842-158139864 GCCACACTTCTGTCCTCCCTGGG + Intergenic
944685109 2:202111095-202111117 TCCCCACCTGGGGCCTTCCTAGG + Intronic
946391641 2:219419913-219419935 CCACTTCCTGTGCCCTCCCTGGG + Intronic
946858693 2:223978969-223978991 CCCCTCCCTGTGTCCTCACATGG - Intronic
947746864 2:232512368-232512390 CCACCAAGTGTGGCCTCCCTGGG + Intergenic
947828425 2:233122242-233122264 TCCCTACCTGTGTCCTCCTCAGG - Exonic
947941172 2:234056985-234057007 CCTCCATCTCTCTCCTCCCTGGG + Intronic
947982046 2:234418807-234418829 GCTCCGCCTGTGTGCTCCCTTGG + Intergenic
948514199 2:238493352-238493374 CCCACCCTTGTGTCCTTCCTTGG + Intergenic
948524843 2:238565092-238565114 CCTCCCGCTGTGTCCTCACTTGG - Intergenic
948759170 2:240179837-240179859 GCCCCACCTGTGCCAGCCCTAGG + Intergenic
948982991 2:241504339-241504361 CCCCCTGCTGTTTCCTCCATGGG - Intronic
1168997895 20:2146328-2146350 CCCCCTCCTGCGTCTTCACTGGG + Exonic
1170573208 20:17644047-17644069 CCCTCTCCTTTGTCCTCCCAAGG - Intronic
1171433566 20:25102736-25102758 GCCCCAACAGTGTCCTTCCTGGG - Intergenic
1171481937 20:25460874-25460896 CCCGCACCTGTGTCCACACTGGG + Intronic
1173057046 20:39624764-39624786 CCCCCTTCTGTGTCCTCACATGG + Intergenic
1173737678 20:45373324-45373346 CCTCCAAATGTGTCCTGCCTTGG - Exonic
1173955651 20:47030532-47030554 GCACCGCCTGTATCCTCCCTGGG - Intronic
1175195409 20:57239876-57239898 CCCCCTGCTGTGTGCACCCTAGG - Intronic
1175665718 20:60858058-60858080 TTCCCTCCTGTCTCCTCCCTCGG + Intergenic
1175776812 20:61658861-61658883 CCCCTACCCTGGTCCTCCCTGGG - Intronic
1176237383 20:64059912-64059934 TCCCCACCTGATTTCTCCCTGGG - Intronic
1178477107 21:32946592-32946614 CCAGCACCTGTGGCTTCCCTTGG - Intergenic
1178724070 21:35035776-35035798 CCCCCACCTGTGCCCCACATGGG - Intronic
1179217638 21:39380982-39381004 CCCCAACCTGGTTGCTCCCTTGG - Intronic
1179593678 21:42428090-42428112 CCCCTCCCTGTGTCCTCACAGGG - Intronic
1179659553 21:42865639-42865661 CCCCATTCTGTGACCTCCCTTGG - Intronic
1179709824 21:43206874-43206896 CCCCCACCTACCCCCTCCCTTGG - Intergenic
1180034320 21:45235908-45235930 CCCCCACCTATTTTTTCCCTCGG - Intergenic
1180086260 21:45509280-45509302 CCTCCATCTGTGTCCTCCTCTGG - Intronic
1180859504 22:19069225-19069247 ACCCTCCCTGTGACCTCCCTTGG - Intronic
1181054252 22:20252664-20252686 CTCCCTGCTGTGTCATCCCTGGG - Intronic
1181376120 22:22459653-22459675 CCAGCAGCTGTGTCCTCCCAGGG + Intergenic
1181493375 22:23274569-23274591 GCCCAGCCTGTGTCCTGCCTGGG - Intronic
1183199594 22:36376656-36376678 CCACCACCTTTCTCCTCCCAGGG + Intronic
1183271421 22:36864897-36864919 CCACAACCTCTGTCCTCCTTAGG + Exonic
1183373592 22:37449423-37449445 CCCCCGCCTGTGCCCCCACTGGG - Intergenic
1183604433 22:38860349-38860371 CCCTGCCCTGTCTCCTCCCTCGG - Intergenic
1184097635 22:42325218-42325240 CCACCACCTCTGTGCTCCCCTGG + Intronic
1184336833 22:43858783-43858805 CCCAGCCCTTTGTCCTCCCTAGG + Intronic
1184679874 22:46064782-46064804 GCCCTACCTGCGTTCTCCCTGGG - Intronic
1184755846 22:46515257-46515279 CCCCCACCTGGGCCCTCCTGGGG + Intronic
1185128812 22:49025940-49025962 CCCCCTCAGGTGTCCTCCCCAGG - Intergenic
1185273864 22:49941550-49941572 CCCCCAGCCGTGTCCGCTCTTGG - Intergenic
950112819 3:10430971-10430993 CTCCCACCTCTTTCCTCACTGGG - Intronic
950113167 3:10433430-10433452 CTCCCACCTCTTTCCTCACTGGG - Intronic
950868781 3:16211254-16211276 ATCCCACCTCTGTCCTCCCTTGG - Intronic
952181995 3:30926653-30926675 CTCCTACCAGTGTCCTCCATAGG - Intergenic
952240618 3:31528434-31528456 CTCCGACCTGTGTCATTCCTGGG + Intergenic
954155227 3:48681630-48681652 CCCCCACCTGTGCCCCGCCGAGG - Exonic
954222152 3:49161507-49161529 CCCCTGGGTGTGTCCTCCCTTGG - Intergenic
954390550 3:50266049-50266071 CCTCCACCTGTGTTCACTCTGGG - Intergenic
954390656 3:50266500-50266522 CCCCCACCTCTGTCCTTGCTTGG + Intergenic
954748890 3:52802823-52802845 CCCCCACCTGTGCCTACCCCTGG + Intronic
955215585 3:56982750-56982772 TCCCCACCTGTCTGCTGCCTTGG + Intronic
956162818 3:66372842-66372864 CCACCTCCTGTCTCCTCCCCGGG + Intronic
956694117 3:71904214-71904236 TCCCCACCTCTGTCCTCACACGG - Intergenic
959074063 3:101731997-101732019 CCCTCTCCTGTGTCTTTCCTAGG - Intronic
960046134 3:113200335-113200357 CCCCTGCCTCTCTCCTCCCTGGG + Intergenic
960147481 3:114218512-114218534 CCCCCTCCTGTCTCCTTCCCTGG - Intergenic
960435710 3:117624055-117624077 CAGCCACCTGTGTGTTCCCTGGG - Intergenic
961269035 3:125673741-125673763 CCCACACCTGTCTCTTCTCTGGG - Intergenic
961723309 3:128909952-128909974 CCCCCACATGGTCCCTCCCTGGG - Exonic
962076361 3:132086295-132086317 ACAGCATCTGTGTCCTCCCTAGG - Intronic
963295457 3:143541291-143541313 CTTCCACCTGTGTCCTCCATCGG - Intronic
968552022 4:1228703-1228725 CCCCCTCCTGTGTCCTCGCCAGG - Intronic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
969428690 4:7140575-7140597 GCCCCAGCTGTGTCTTGCCTTGG + Intergenic
970299825 4:14669480-14669502 CAGCCAGATGTGTCCTCCCTAGG + Intergenic
973290305 4:48464324-48464346 TCCCCACCTGTGTATGCCCTGGG + Intergenic
975323006 4:73029320-73029342 TCCCCATCTCTGTCCTCCTTGGG + Intergenic
980054624 4:128067663-128067685 CTCCCATCTGTGTCCTGACTTGG + Intronic
980242244 4:130191613-130191635 CCCCCAACTGTGTGCAGCCTTGG - Intergenic
980865959 4:138553430-138553452 CCCCCACCAGTGGGCTCCCGCGG + Intergenic
982101143 4:151969075-151969097 CCCCATCCTGTGTCCTCTCCAGG + Intergenic
982528147 4:156505547-156505569 TCCCCATCTGGGACCTCCCTTGG - Intergenic
983103057 4:163649826-163649848 CCCTCACTTGGGTCCTCTCTAGG - Intronic
983337536 4:166415995-166416017 CCCCCTGCTGTGTGCTGCCTAGG - Intergenic
986109258 5:4695025-4695047 CCCACACCTGCCTCCACCCTTGG - Intergenic
986280145 5:6315896-6315918 CACCCACCTGTTTCCATCCTGGG - Intergenic
986812405 5:11373950-11373972 CCACAACCTGTGACCTCCCAGGG - Intronic
989417993 5:41203081-41203103 CACCCACCTGTGTCTGCTCTGGG + Exonic
990792213 5:59495057-59495079 TCCCCACCAGTTTCCTCCCTAGG + Intronic
990873668 5:60461234-60461256 CCCCCAACTGTGTATTTCCTGGG - Intronic
991608442 5:68426467-68426489 CCCACACCTGTGTGGTGCCTTGG + Intergenic
995453804 5:112331464-112331486 CCCCCAACTGAGTGTTCCCTGGG + Intronic
995591009 5:113699561-113699583 CCCCCTCCTGTGTGCAGCCTGGG - Intergenic
995779676 5:115762156-115762178 CTCCCACCAGGGCCCTCCCTGGG + Intergenic
997206642 5:132054101-132054123 CCCCCAGCTCTGTCCTGCCCAGG + Intergenic
998108240 5:139481942-139481964 ACCACACCTGTGGTCTCCCTGGG - Intronic
998132658 5:139659241-139659263 CCCCCACCTCAGTCCTTCCCCGG - Intronic
999858418 5:155619863-155619885 CTCAGAGCTGTGTCCTCCCTGGG - Intergenic
1000703816 5:164486726-164486748 AGCTCACCTGTGTCTTCCCTGGG - Intergenic
1001835070 5:174824792-174824814 CCCCCACCTGCGTGCTCCATGGG + Intergenic
1002470297 5:179431007-179431029 CCTCTACCTGTGTCCTCCAGTGG + Intergenic
1002683217 5:180985982-180986004 CCTCCTCCTCTGTCCTGCCTGGG - Intergenic
1002820420 6:719470-719492 CCCCTTGCTGTGTCCTCCCATGG - Intergenic
1003723472 6:8732760-8732782 CCTCCTCCTATGTCCTCCCATGG - Intergenic
1006193017 6:32220962-32220984 CCCCCAGGTGTGTCCTCACAGGG - Exonic
1006360179 6:33583334-33583356 CACACACCTCTGTCCTTCCTGGG - Intergenic
1006403495 6:33831201-33831223 TCCCCTCCTCTGTCCTCCCCGGG + Intergenic
1007178230 6:39910833-39910855 CCCCCAGCTGGCTCCTGCCTGGG + Intronic
1007842404 6:44727597-44727619 CCCCCACCTTTCACCGCCCTAGG + Intergenic
1009316119 6:62223349-62223371 CCCCAACCTGTGTGCAGCCTAGG - Intronic
1011264111 6:85497538-85497560 CCCCCTGCTGTGTCCAGCCTAGG - Intergenic
1011343751 6:86346612-86346634 CCCCCCACAGTGTCCTCACTGGG - Intergenic
1011784199 6:90826203-90826225 CCCCCTCCTGTGTGCACCCTGGG + Intergenic
1011985947 6:93446210-93446232 CCTCCTCCTGTGTTCTGCCTCGG + Intergenic
1012818722 6:104057798-104057820 CCCCCAACTGGGGCCTCCCCAGG - Intergenic
1015127255 6:129768748-129768770 CCCTCACCTGTGTCCTGTGTGGG - Intergenic
1015366233 6:132401087-132401109 CCCGCACCTGCGCCCTCTCTGGG + Intronic
1015658400 6:135545928-135545950 CACACATCTGTGTCTTCCCTTGG + Intergenic
1017429184 6:154354206-154354228 CCCCCAACTGTGTTTTCTCTTGG + Intronic
1018670458 6:166172617-166172639 CCCACACCTCTGTCTTCCCAAGG - Intergenic
1019273787 7:165169-165191 CCTCCACCTGTTCCCTCCCCAGG - Intergenic
1019356852 7:584746-584768 CCCCCACCTCCCTCCTCCCGGGG + Intronic
1019785980 7:2977764-2977786 CCACAACCTGTCTCATCCCTTGG - Intronic
1020084996 7:5305413-5305435 CCCCCACCTATAGCTTCCCTAGG + Exonic
1020110695 7:5446338-5446360 TCCCCTCCTGTGTCCCCCATGGG - Intronic
1022104705 7:27189519-27189541 CACCCAGCTGTATCCTCCCTTGG - Intergenic
1022504669 7:30902753-30902775 CCCCCACGTGGGTGCTCCCCTGG - Intergenic
1024930153 7:54660753-54660775 CCTCTAGCTGTGTCCTTCCTTGG - Intergenic
1026955299 7:74372901-74372923 CCCCCCACCGTGTCCACCCTGGG + Intronic
1028238467 7:88389612-88389634 TCCCCACCTTTGTCCTCTCTGGG + Intergenic
1029188566 7:98756069-98756091 CCCCAACCTGGGTCCTCTGTGGG - Intergenic
1029479070 7:100802163-100802185 CCCCCATCTGTGTCCATCCACGG + Intergenic
1029519356 7:101050374-101050396 CCCCCAGCTCTGCCTTCCCTTGG + Intronic
1030608462 7:111663577-111663599 CTCCCACCTGGCTCCTCCCATGG + Intergenic
1031149544 7:118037219-118037241 CTCCTACCTGTGACTTCCCTTGG + Intergenic
1031766679 7:125786828-125786850 CCCCCCACTGTGTCCTCACGTGG + Intergenic
1032014161 7:128366297-128366319 CCCCCTCCAGTGTCTTCCCAGGG - Intergenic
1032085535 7:128881565-128881587 CCCCTTCCTGTGTTCCCCCTGGG + Intronic
1033283443 7:140021821-140021843 CCACAACCTGAGTCCTCCCTTGG + Intergenic
1033820286 7:145126529-145126551 CTCCCACCTGGTTCCACCCTTGG - Intergenic
1034436038 7:151063174-151063196 CCCCCACCTGAGTCATCCTGCGG - Intronic
1035311864 7:157974696-157974718 CCGCTACCTGTGTCTTCCCATGG - Intronic
1035489222 7:159257630-159257652 CCAACTCCTGTGTCCTCGCTCGG + Intergenic
1035702113 8:1644118-1644140 CCCTCACCTGTGTCACCCCTCGG + Intronic
1036222072 8:6929470-6929492 CCCCCACCTGTAGCTTCCCCAGG - Intergenic
1036662418 8:10716656-10716678 CCACCACCTGTTCCCTCCCACGG + Intergenic
1038022963 8:23565346-23565368 TCCCCTCCTCTGTCATCCCTAGG - Intronic
1039880551 8:41622710-41622732 CACCTACCTGTGACCTCCCTGGG + Exonic
1040284544 8:46093179-46093201 ACCCCACCTGTGGGCACCCTGGG - Intergenic
1040323318 8:46329200-46329222 CCACCACCTGTGTAGGCCCTTGG + Intergenic
1042489552 8:69381672-69381694 CCCCTGCTTGTGTTCTCCCTGGG + Intergenic
1042844288 8:73154881-73154903 CTGCCTCCTGTGACCTCCCTGGG - Intergenic
1043492469 8:80763213-80763235 CCCCCACCAGAGTCCCCACTGGG - Intronic
1047445198 8:124913373-124913395 TCCCCGCCTGTGTGCTCCCCTGG + Intergenic
1047688302 8:127323486-127323508 CCCACTCCTGTGGCTTCCCTGGG - Intergenic
1048581768 8:135734842-135734864 CCCCCACCTTTTTCCTGTCTAGG + Intergenic
1049257025 8:141619625-141619647 CGCTCTCCTGTGTCCTCCCCTGG - Intergenic
1049347765 8:142147870-142147892 CCCCACCCTGTGTCCACCTTTGG + Intergenic
1049521599 8:143094301-143094323 CCCCCACCTGGGTGAGCCCTGGG + Intergenic
1051471764 9:17451676-17451698 CCACCAGCTGTTTCCTCCATGGG + Intronic
1055812356 9:80163722-80163744 CCCCTAACTCTGTCCTCCCAAGG + Intergenic
1056557788 9:87704200-87704222 CCTTCACCTGTGTTCTTCCTTGG - Intronic
1056789279 9:89615224-89615246 CCCCCAGCTGCGTCCTCCAAGGG + Intergenic
1056860038 9:90172672-90172694 GCCCCATCTGTGTCCTGCCTGGG + Intergenic
1057180230 9:93025893-93025915 CCACGCCCTGTGTCCACCCTCGG + Intronic
1057717202 9:97503970-97503992 TGCCCACCTCTGTCCTCCCTTGG - Intronic
1058153639 9:101487555-101487577 CCCCCACATTTTTCCTCCCTCGG - Intronic
1058307773 9:103464279-103464301 CCCCCTCCTGTGTGCAGCCTAGG - Intergenic
1058639309 9:107067506-107067528 TCCCCACCTGTGTATTTCCTGGG - Intergenic
1058879976 9:109277705-109277727 ACCTCACCTGTGTCCTCACTTGG - Intronic
1059384031 9:113950288-113950310 CCCCCACCTCTGTCCTTCTCTGG + Intronic
1059421063 9:114192682-114192704 AACCCACCTTTGTCCTTCCTTGG + Intronic
1059434067 9:114266001-114266023 CCCCCACACCTGTCCTCCCAGGG - Intronic
1059740315 9:117143757-117143779 CTCCTCCCTGTGTCCTCACTCGG + Intronic
1060384581 9:123213093-123213115 CACCCACCTATGTGCTCCCAAGG + Intronic
1062042995 9:134412618-134412640 CCCCCACCTCTGCCCACCCCTGG - Intronic
1062075875 9:134589761-134589783 CCCTCACCTGTGTACTCCTGGGG + Intergenic
1062209454 9:135355921-135355943 GCCCCATCTGTTTCCTCCCGAGG + Intergenic
1062261862 9:135666833-135666855 TCCCCTCCTGTCCCCTCCCTGGG + Intergenic
1062385348 9:136307156-136307178 CCTCCACCTGGGTCACCCCTGGG - Intergenic
1062461196 9:136663215-136663237 CCCTCCCCTGTGACCTCGCTGGG - Intronic
1062464385 9:136674709-136674731 CCCCCACATGTGTGCACCCGGGG - Intronic
1062544364 9:137054914-137054936 GCCCCACCTGTTTCCGTCCTGGG - Intergenic
1062622399 9:137428798-137428820 CCCCCACCCAGCTCCTCCCTCGG - Intronic
1062730153 9:138104107-138104129 CCCCACCCTGAGGCCTCCCTTGG - Intronic
1185747888 X:2586061-2586083 CTCCCACCTGTGTCATCCTGGGG - Intergenic
1186788321 X:12973771-12973793 CCCCCACCTCCTTCCTCCCCAGG + Intergenic
1188244047 X:27820196-27820218 CTCCAACCTGGGACCTCCCTGGG - Intronic
1189331369 X:40146697-40146719 CCCGCCCCCGTGGCCTCCCTAGG + Intronic
1189896123 X:45658596-45658618 CCCCCTGCTGTGTGCACCCTAGG + Intergenic
1190269699 X:48853038-48853060 CCCCCTCCTGTGTGCAGCCTAGG - Intergenic
1190817025 X:53938151-53938173 CCCACACCTGGGTCCTCCATCGG - Exonic
1192538150 X:71946154-71946176 CCCCCTTCTCTGTCCTCCCATGG - Intergenic
1193816235 X:86107648-86107670 CCCCCAGCTGTGTGCAGCCTTGG - Intergenic
1197282052 X:124548756-124548778 CCCCCACTTGTCTGCTCCCGTGG + Intronic
1197768790 X:130075942-130075964 CCTCCTCCTGGGCCCTCCCTTGG - Intronic
1197888409 X:131241685-131241707 CCTCTTCCTGTGTCCTCTCTAGG + Intergenic
1199265341 X:145821195-145821217 CCCCCACCCCTGCCCTCCATAGG + Exonic
1199531533 X:148853326-148853348 CCCACATCTGTGACCTCTCTAGG - Intronic
1199627076 X:149750630-149750652 CCCCAACCTGGGGCTTCCCTGGG - Intergenic
1199757134 X:150875038-150875060 CTGCCACCTCTTTCCTCCCTTGG + Intronic
1200236119 X:154468582-154468604 GCCACACCTTTGTCCTGCCTGGG + Intronic
1201411255 Y:13701622-13701644 TCCCCACCTTCTTCCTCCCTAGG + Intergenic
1201532685 Y:15009642-15009664 CTTCTCCCTGTGTCCTCCCTGGG - Intergenic
1202080732 Y:21081484-21081506 CTCCTGCCTGGGTCCTCCCTGGG + Intergenic